ID: 1035683205

View in Genome Browser
Species Human (GRCh38)
Location 8:1503880-1503902
Sequence ACGTGGGTGGAGGACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035683198_1035683205 -7 Left 1035683198 8:1503864-1503886 CCCCTCTTGGGGTGGTACGTGGG No data
Right 1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG No data
1035683190_1035683205 16 Left 1035683190 8:1503841-1503863 CCCTCAAACACGTGCCTGGCTTT No data
Right 1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG No data
1035683201_1035683205 -9 Left 1035683201 8:1503866-1503888 CCTCTTGGGGTGGTACGTGGGTG No data
Right 1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG No data
1035683200_1035683205 -8 Left 1035683200 8:1503865-1503887 CCCTCTTGGGGTGGTACGTGGGT No data
Right 1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG No data
1035683191_1035683205 15 Left 1035683191 8:1503842-1503864 CCTCAAACACGTGCCTGGCTTTC No data
Right 1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG No data
1035683195_1035683205 2 Left 1035683195 8:1503855-1503877 CCTGGCTTTCCCCTCTTGGGGTG No data
Right 1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035683205 Original CRISPR ACGTGGGTGGAGGACTCTGG AGG Intronic