ID: 1035684398

View in Genome Browser
Species Human (GRCh38)
Location 8:1512902-1512924
Sequence GTGCACACACAGATGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035684398_1035684406 10 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684406 8:1512935-1512957 CAGGCCACAGCGGAGAAAGATGG No data
1035684398_1035684407 11 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684407 8:1512936-1512958 AGGCCACAGCGGAGAAAGATGGG No data
1035684398_1035684411 28 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684411 8:1512953-1512975 GATGGGAGAGGCCACAGGCCAGG No data
1035684398_1035684410 23 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684410 8:1512948-1512970 AGAAAGATGGGAGAGGCCACAGG No data
1035684398_1035684409 16 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684409 8:1512941-1512963 ACAGCGGAGAAAGATGGGAGAGG No data
1035684398_1035684402 -9 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684402 8:1512916-1512938 TGTGTGCACGTTGGTGTCCCAGG No data
1035684398_1035684403 0 Left 1035684398 8:1512902-1512924 CCCTGTGCCATCTGTGTGTGCAC 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1035684403 8:1512925-1512947 GTTGGTGTCCCAGGCCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035684398 Original CRISPR GTGCACACACAGATGGCACA GGG (reversed) Intronic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900177612 1:1297768-1297790 GTGCACACACACGTGCCACCGGG - Intronic
900740267 1:4326855-4326877 GTGCACACGGAAATGGCACGGGG + Intergenic
902718012 1:18285931-18285953 GTGAACACACAGAGAGCCCAGGG - Intronic
903501485 1:23802398-23802420 GGGCACACACAGATGATTCATGG - Exonic
905499802 1:38427416-38427438 GGTCCCACACAGATGGAACACGG - Intergenic
906966662 1:50464119-50464141 GAGGACACAGACATGGCACATGG - Intronic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909180160 1:72413743-72413765 GGGCACTCACACATGACACATGG + Intergenic
909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG + Intergenic
910584754 1:88866813-88866835 TTGCATACAGGGATGGCACATGG - Intronic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
912458985 1:109818757-109818779 GTGCCCAGACAGAGGTCACAGGG - Intergenic
912647945 1:111412938-111412960 GTGCATACACACACGGCAAAAGG + Intergenic
913594436 1:120359775-120359797 GTGTACACACAGATGGCTGAAGG - Intergenic
914092826 1:144519209-144519231 GTGTACACACAGATGGCTGAAGG + Intergenic
914305702 1:146414664-146414686 GTGTACACACAGATGGCTGAAGG - Intergenic
914596353 1:149158142-149158164 GTGTACACACAGATGGCTGAAGG + Intergenic
915532171 1:156508998-156509020 GTGGACACAGAGATGGCACCAGG + Intergenic
915799998 1:158780821-158780843 GTGCTGACACAGATGGTAGAAGG - Intergenic
916941813 1:169685202-169685224 GGTCCCACACAGATGGAACATGG - Intronic
918465832 1:184820573-184820595 GTGCATACACGAATGGGACATGG - Intronic
921331250 1:214039031-214039053 GCGCACACATATATAGCACATGG - Exonic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
1062804721 10:409330-409352 GTGCACACACCGTCGTCACAGGG + Intronic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1063313041 10:4973415-4973437 GCGCTCACACAGATGCCCCAGGG - Intronic
1063370948 10:5522976-5522998 CTGCACACACAGCTTGCTCAAGG - Intergenic
1063633406 10:7756555-7756577 GTGCACACAGACATGGCAACTGG + Intronic
1063867987 10:10388044-10388066 GACCACTCACAGATGTCACAAGG + Intergenic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1065512033 10:26488917-26488939 GTGTACATACACATGGGACAAGG - Intronic
1067734958 10:48843443-48843465 ATGAACACAGAGATGACACATGG + Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068322809 10:55441899-55441921 GGGCACACACAGAGAGCACAAGG + Intronic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1069614717 10:69799811-69799833 GTGAACACAGTGCTGGCACAGGG - Intergenic
1073045858 10:100637842-100637864 GTGTACACACAGGATGCACATGG - Intergenic
1073177653 10:101566204-101566226 GTGCACACGAAGCTGGCAGAGGG + Intergenic
1075603371 10:123787202-123787224 GTGCAGACAGAGATGGAAAAGGG + Intronic
1076530919 10:131143565-131143587 GTGCACAGCCAGATGGCAGGGGG + Intronic
1076868463 10:133181169-133181191 GGGCACCCACAGATGCCACATGG + Intronic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1079120072 11:17676243-17676265 GTCCACACAAAAATTGCACATGG + Intergenic
1079503785 11:21132237-21132259 GTGCACACACACAGGGCAATGGG + Intronic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1081599349 11:44482053-44482075 GTGCACACAAAGAATGAACAAGG + Intergenic
1082812128 11:57484725-57484747 GTGTGCACACTCATGGCACATGG + Exonic
1083853145 11:65379336-65379358 GGGCACACACAGGTGTCATAGGG - Intronic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1084953972 11:72681586-72681608 GAGCACACACACACGGCACGTGG - Intergenic
1086125285 11:83343461-83343483 GATCCCACACAGATGGGACATGG + Intergenic
1088225797 11:107618463-107618485 GTGCAGAGACACATGGCACCAGG - Intronic
1089203328 11:116738885-116738907 GAGCACACAGAGATGGCTGAAGG - Intergenic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1091782736 12:3224261-3224283 GTGCACTTACAGATGGGACCGGG + Intronic
1092960993 12:13596969-13596991 GTCCACACAAAGAAGACACAGGG + Intronic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1096809382 12:54159939-54159961 GCACACACAAAGAAGGCACAAGG - Intergenic
1097296085 12:57964560-57964582 GTGCACACCCACCTGCCACAAGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1104904999 12:132208392-132208414 CTGCACACACAGACGCCAGAAGG - Intronic
1105848344 13:24312162-24312184 GTCCACACACAGTTGGAACCAGG + Intronic
1106062687 13:26310222-26310244 ATGCACACACAGAGAGCAGATGG - Intronic
1107183148 13:37485506-37485528 TTGCACACACAGAACACACAAGG - Intergenic
1107469281 13:40677271-40677293 GTGTACACACAGTTGACACGTGG - Intergenic
1108167479 13:47708638-47708660 TTGCAGACACAGAGGGCACGAGG - Intergenic
1108323798 13:49310391-49310413 GTAGACACACAGATCGCTCAGGG - Exonic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1110081687 13:71321634-71321656 TTGCACACACAGTTAGTACAGGG - Intergenic
1110131694 13:72019162-72019184 GTGGACAGGCAGTTGGCACAAGG + Intergenic
1110400540 13:75085471-75085493 GTCCAGACACAGATATCACAAGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111486949 13:88915539-88915561 GTGCACACACATAAGACAGAAGG + Intergenic
1112994141 13:105552078-105552100 TTGCACACACACAGCGCACACGG - Intergenic
1114866735 14:26604360-26604382 GTAAACACACAGATGGCATCAGG + Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1117149512 14:52871362-52871384 GAGCACACACCCTTGGCACATGG - Intronic
1118042880 14:61936673-61936695 GGGGACAGACAGGTGGCACAGGG - Intergenic
1118120767 14:62839444-62839466 GTGACAGCACAGATGGCACAGGG - Intronic
1118272542 14:64356937-64356959 GAGCACACACAGCTGGCAAATGG + Intergenic
1118501303 14:66364997-66365019 GTGCACCAGCAGATGGGACATGG - Intergenic
1119650901 14:76382138-76382160 GTGCACACACAGGTTTCCCACGG - Intronic
1120016796 14:79483002-79483024 GTGCACACACAGCTTGAAAAAGG - Intronic
1120434647 14:84465898-84465920 GTGTACAAACAGGTGACACATGG - Intergenic
1122017219 14:98806304-98806326 GTGCAGACACAGTTTGCACATGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1122421978 14:101583484-101583506 GTGCAAGCACAGACGACACACGG + Intergenic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1124160961 15:27269386-27269408 CAGCACACACAGAAAGCACAGGG - Intronic
1128564769 15:68693654-68693676 GTCCACAAACGGATGGAACAAGG - Intronic
1131511038 15:93049667-93049689 ATGCACACACAGCTTGCACACGG + Intronic
1133838951 16:9391519-9391541 GTGAAGACACAGAAGTCACAAGG + Intergenic
1134021829 16:10926358-10926380 GCGCACACACAGGAGGCCCATGG - Exonic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1136529975 16:30861492-30861514 GATCCCACACAGATGGGACACGG - Intronic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137696314 16:50464508-50464530 GGACACACACAGCTGGTACATGG + Intergenic
1138345225 16:56316416-56316438 GTGGGCACACAGATGGCTCAGGG - Intronic
1138686219 16:58728280-58728302 GTGCTCACACAGCTGGCAGGTGG - Intronic
1138804971 16:60081168-60081190 GGTCACACACAGATGGGACGCGG - Intergenic
1140288658 16:73629146-73629168 GCACACACACAGATGACACACGG - Intergenic
1141920374 16:87131810-87131832 GAGGGCCCACAGATGGCACACGG + Intronic
1142262522 16:89049619-89049641 GTGCCCGCACAGCTGGCACTGGG + Intergenic
1142354132 16:89594176-89594198 GTGCTCGCACAGTTGGCAGAGGG + Intronic
1142562022 17:815868-815890 GTGCACACACAGAGGCCAGTAGG + Intronic
1143477004 17:7208531-7208553 GTGAAGACACAGATGCCAGAGGG - Intronic
1144439005 17:15264838-15264860 GTGCACACACAGCTGGCAGGTGG - Intronic
1144765333 17:17729437-17729459 GGGAACACAGAGGTGGCACATGG - Intronic
1145115073 17:20202073-20202095 ATGCACACACAGACTGTACATGG + Intronic
1145247688 17:21280322-21280344 ATGCACACACACATGACACAAGG - Intergenic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1147177223 17:38663482-38663504 GTGCCTACCCAGTTGGCACAGGG + Intergenic
1147254580 17:39174381-39174403 CTCCACACCCAGGTGGCACAGGG + Exonic
1147980677 17:44272232-44272254 GTGGACATCCAGATGGCACGGGG + Intergenic
1149634308 17:58154455-58154477 TTGCCCCCACAGATGGCCCATGG + Intergenic
1151558486 17:74859073-74859095 GTGCACACACACCTGCCGCAGGG - Intronic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1156976932 18:43233902-43233924 GAACACACAGAGATGGCAGAAGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1158441649 18:57479967-57479989 GTGCAACCACAGCTGGCACTGGG + Exonic
1158492705 18:57924605-57924627 GTGGACACAAAGATGTCACAAGG - Intergenic
1159924000 18:74250569-74250591 GTGCAGACACAGATGGCGTCCGG - Intergenic
1160426039 18:78779991-78780013 ATGCACCCCCAGATGGCTCATGG + Intergenic
1162781836 19:13010699-13010721 GTGCCCACACACATGGCTCCAGG + Intronic
1163371560 19:16903982-16904004 GTGCAGACACCCATGGCACTGGG + Intronic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164725050 19:30460660-30460682 CTGCACACACAGTGGCCACATGG - Intronic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1166329846 19:42071438-42071460 TCGAACACACAGCTGGCACATGG + Intronic
1166532558 19:43551930-43551952 GTGGACACAGAGAAAGCACAAGG + Intronic
1166663358 19:44661786-44661808 ATCCACAGACAGAGGGCACAAGG + Exonic
1167035613 19:46993567-46993589 GGGGACAGACAGAGGGCACAGGG - Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925603126 2:5629129-5629151 GTGTACACACAGATGGCTGAAGG - Intergenic
926630971 2:15136000-15136022 GGGCACACACAGATGCAAGAGGG + Intergenic
927206396 2:20613786-20613808 GAGTACACAGGGATGGCACAGGG + Intronic
927368466 2:22326899-22326921 GTGCACACACAGAGAGAAGAAGG + Intergenic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
930259289 2:49126305-49126327 GTGCACACACAAAAGGAAGAGGG + Intronic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
931777012 2:65549449-65549471 ATAAACACCCAGATGGCACAAGG - Intergenic
931967719 2:67551854-67551876 GTGTACAAAGAAATGGCACATGG + Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932926003 2:75975393-75975415 GTGCACACACATAAGACACATGG + Intergenic
933693898 2:85201325-85201347 TTGCACACACAGACTGTACATGG - Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
937921073 2:127131303-127131325 GTGCCTTCACAGATGGCAGAAGG - Intergenic
938320382 2:130358727-130358749 GTGCAGACCCTGATGGCACTGGG - Intronic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
940799582 2:158118653-158118675 GTGCAAATACAGACTGCACATGG + Intronic
941707935 2:168679648-168679670 GCTCACACACAGATAGGACATGG + Intronic
941835607 2:170015334-170015356 GTGCAAGCACAGCTGGCAAAAGG + Exonic
941989078 2:171537268-171537290 GATCACACACAGATTGCAGAAGG + Intronic
944165664 2:196717313-196717335 GTGAATACAGAGATAGCACAAGG + Intronic
944260700 2:197673127-197673149 GAGCACACACAGCTGTCACCAGG + Intronic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945516102 2:210764795-210764817 GTGCCCATACAGCTGGCTCAAGG + Intergenic
946668089 2:222072404-222072426 GTGGACACTCAGAGGGCAGATGG - Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
947897859 2:233692206-233692228 GGGCACCCAGAGATGGCAGATGG + Intronic
948876952 2:240834569-240834591 TTGCACCCACAGAGGGCGCAAGG + Intergenic
1172166612 20:32903407-32903429 GTGGACACACAGAAGGGAGATGG - Intronic
1172890247 20:38259240-38259262 GTGTACACACACATGGCTCTTGG - Intronic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173150975 20:40566181-40566203 GTGCACACAGAGCTGGCAGATGG - Intergenic
1173201830 20:40960351-40960373 GTGCACACAGAGTGGGGACAAGG + Intergenic
1173361077 20:42344869-42344891 GCGCACACAGAGAAGGTACAGGG - Intronic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174654629 20:52160385-52160407 ATACACACACAGATGGCAGCAGG + Intronic
1174726632 20:52869415-52869437 GTGCATTCAGAGACGGCACATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177100646 21:16894513-16894535 GATCCCACACAGATGGGACATGG - Intergenic
1177901471 21:26922032-26922054 TTGCACAGACAAATGGCACTGGG + Exonic
1179726099 21:43341922-43341944 GTGCCACCACACATGGCACATGG - Intergenic
1180560965 22:16613966-16613988 GTGCCTGCACAGATGGGACATGG - Intergenic
1181393546 22:22601347-22601369 ATTCACACACAGTCGGCACATGG - Intergenic
1182353678 22:29712631-29712653 GAGGACAGACAGATGGCAGAGGG - Intergenic
1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG + Intronic
1184909992 22:47525295-47525317 GTGCACACACCAATGACCCATGG - Intergenic
950118645 3:10467500-10467522 TGGCAGACACAGTTGGCACATGG + Intronic
952895196 3:38074037-38074059 GTCCTTACACAGATGGGACATGG + Intronic
952946604 3:38482133-38482155 ATACACACACAGCTGGGACATGG - Intronic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
955707171 3:61739757-61739779 GTGCAAACACAGATGGCCACAGG + Intronic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
956807095 3:72826230-72826252 GTGCACAGACATATGAGACAAGG + Intronic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961562133 3:127737955-127737977 ATGCATTCACATATGGCACATGG + Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961870667 3:129985440-129985462 GTGGCCAAAGAGATGGCACAAGG + Intergenic
963043489 3:141085842-141085864 CTGCAAACAGAGCTGGCACATGG + Intronic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963732809 3:148989191-148989213 ATGCGCACACAGATTGCCCAAGG - Intergenic
966124686 3:176562134-176562156 GTGCACACTCTTATGGCCCAGGG - Intergenic
966397674 3:179519198-179519220 GGTCCCACACAGATGGCACATGG - Intergenic
966398429 3:179524307-179524329 GGTCCCACACAGATGGCACATGG + Intergenic
968789335 4:2648712-2648734 GTGCACCCACAGATGGCAGAGGG - Intronic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
971725003 4:30300228-30300250 GTGCAGACACCCATGGGACATGG - Intergenic
972329288 4:38049614-38049636 TTTCACACACAGATGGCTCCTGG - Exonic
972409053 4:38773733-38773755 ATGCACACAAACATGGCACAGGG - Exonic
973583351 4:52366736-52366758 GTCCACAGCCAGATGGAACAAGG + Intergenic
973631590 4:52825357-52825379 GTTCACACAAAGATAGCCCAAGG - Intergenic
975846884 4:78534485-78534507 GTGAATACACAACTGGCACAGGG - Intronic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977238715 4:94541010-94541032 GTATACACGCAGATGGTACATGG - Intronic
977681948 4:99806932-99806954 GAGCACACACAGATGGTCCAAGG + Intergenic
977808559 4:101332799-101332821 ATGGACACACAGTTGGCATATGG + Intronic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
981525229 4:145701433-145701455 GTCCCCGCACAGATGGGACACGG - Intronic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
984299595 4:177898008-177898030 ATGCACAAACAGAAAGCACAAGG - Intronic
985238371 4:187901846-187901868 GTGGATATACAGATAGCACAAGG + Intergenic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985558372 5:569106-569128 GTGCAGACACCGGTGCCACAGGG + Intergenic
985947734 5:3200038-3200060 GTGCACAGGCAGGTGGAACAAGG - Intergenic
986788895 5:11141668-11141690 GTGCAGACACAGCTGGCCTAAGG - Intronic
986997653 5:13625655-13625677 GGCCACACACACATGGCAGATGG - Intergenic
987882168 5:23762284-23762306 TTCCACACAAAGATGCCACATGG - Intergenic
989659945 5:43788447-43788469 GATCCCACACAGATGGGACATGG - Intergenic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
992653876 5:78889031-78889053 GTACCCCCACAGATGGCACCTGG + Intronic
993520158 5:88889903-88889925 GTGCACAAAGCGCTGGCACACGG + Intronic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994889543 5:105613492-105613514 GTGCACACACACATTGCTCATGG - Intergenic
996917701 5:128731879-128731901 GATCCCACACAGATGGGACATGG - Intronic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
1000409617 5:160924319-160924341 GAGCACACAAAGTTGGCCCAGGG - Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001182038 5:169529532-169529554 GTGCACACACAAACAGCATATGG - Intergenic
1001402250 5:171452352-171452374 GTTGGCACACAGATGGCCCAAGG - Intronic
1001540695 5:172536048-172536070 ATGCACACACACATGACAGAGGG + Intergenic
1002439231 5:179255767-179255789 GCACAGACACTGATGGCACAGGG + Intronic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1004283501 6:14300329-14300351 GTTCCCACACAGATGGGACGCGG + Intergenic
1004341442 6:14811451-14811473 GTGCAGAGACAGATGCCCCAAGG + Intergenic
1004840496 6:19578500-19578522 ATGCACACACAGACCACACATGG + Intergenic
1007465411 6:42048279-42048301 GTGTACATACAGAGGGCTCAGGG + Intronic
1008967891 6:57332894-57332916 GGAAACACATAGATGGCACACGG - Intronic
1010723946 6:79312449-79312471 GTGAACAAGCAGTTGGCACAAGG - Intergenic
1013457093 6:110340170-110340192 GCGCTCACACATCTGGCACAAGG + Intronic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1015484621 6:133754586-133754608 TTGGACACACAGAAAGCACAAGG - Intergenic
1015816495 6:137216997-137217019 GTGCACTCACAGGGGTCACACGG + Intronic
1016408343 6:143755728-143755750 GTGCACACACCAAAGCCACAAGG + Intronic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1018736375 6:166689833-166689855 GTGCACACACCGAGGACACCAGG + Intronic
1018738308 6:166706721-166706743 TTGCACAGACAGTTGGCACGGGG - Intronic
1020175573 7:5879405-5879427 GTGCACACACAGGTCTCACCCGG - Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1024555333 7:50598872-50598894 CTGCACAGGCAGATGACACAGGG + Intronic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1026738009 7:72961037-72961059 AAGCAGACACAGGTGGCACAGGG + Intronic
1026789046 7:73319832-73319854 AAGCAGACACAGGTGGCACAGGG + Intronic
1026872410 7:73861133-73861155 GTGACCTCACAGATGCCACAGGG - Intergenic
1027105725 7:75404031-75404053 AAGCAGACACAGGTGGCACAGGG - Intronic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1027434575 7:78151410-78151432 GTGCTCACACAGATGGATGACGG + Intronic
1028193824 7:87881566-87881588 GTTCACACACAACTGGAACACGG + Intronic
1028527251 7:91800263-91800285 GAACACACACAGATAGCAAATGG + Intronic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1028927846 7:96379573-96379595 GTGCACACACAGAGCACTCAAGG - Intergenic
1031701271 7:124929941-124929963 GTTCACACACTGATGGCGCCTGG + Exonic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033655980 7:143374732-143374754 GTGCGCCCACAGCTGTCACAGGG + Intergenic
1034417644 7:150973699-150973721 GAGCACACAGGGCTGGCACATGG + Intronic
1035100782 7:156394673-156394695 GTGCAGACACAGAGGGCAGGGGG + Intergenic
1035122927 7:156583676-156583698 GTCCACACACACATGGAAGAGGG + Intergenic
1035245102 7:157558135-157558157 GTTCACACACAGATAGGACTCGG - Intronic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1036126082 8:6063600-6063622 GTGCACAAACAGATGTAAAAAGG - Intergenic
1036616913 8:10395259-10395281 GTGCACACACACATTGCAAAGGG + Intronic
1036713774 8:11101074-11101096 GTGCACACACACAATGCTCACGG + Intronic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037311544 8:17561653-17561675 GTGAGGACACAGATGGCACGTGG + Intronic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038751917 8:30303908-30303930 GTGTCCACACAGTTTGCACAAGG - Intergenic
1041004048 8:53482277-53482299 CTGCACAAGCAGACGGCACATGG + Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043598866 8:81915779-81915801 GATCCCACACAGATGGGACATGG - Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1047598256 8:126400345-126400367 ATGCACATACAGACTGCACATGG + Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049215674 8:141406862-141406884 TTGCACATACAGTGGGCACAGGG - Intronic
1049321599 8:141999714-141999736 GACCCCACACCGATGGCACATGG - Intergenic
1049814211 8:144590693-144590715 GTGCACACTGAGATGTCACATGG - Intronic
1050073814 9:1843294-1843316 GTGCACACTCAGAGGACATAGGG + Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1052673660 9:31591032-31591054 GTGCTCACAAATATGTCACATGG + Intergenic
1052991980 9:34523644-34523666 GTCCACACCCAGGTGGCAGAGGG - Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1054822057 9:69532473-69532495 TAACACACACAGATGTCACAGGG - Intronic
1055231251 9:74068618-74068640 ATGCATACACATATGGCATATGG + Intergenic
1055685174 9:78765788-78765810 GTGCAAACTCACATGGCAAAGGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056601761 9:88052407-88052429 TAGCACACACAGATGGCCCGAGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1059000722 9:110345723-110345745 ATACACAAACAGATCGCACATGG + Intergenic
1059389957 9:113992789-113992811 ATGGACACACAGATGGCATTTGG + Intronic
1062133378 9:134912352-134912374 GAGCACACTCAGGTGGCACTGGG - Intronic
1062551449 9:137089312-137089334 GGGCAGAGGCAGATGGCACATGG + Intronic
1062699497 9:137891527-137891549 ATGCACCCACAGAGGTCACAGGG + Intronic
1062732292 9:138116960-138116982 GTGGACGCAGAGATGGCAGAAGG - Intronic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186830483 X:13385040-13385062 GAGCACACACAGCAGGAACAAGG + Intergenic
1187191511 X:17039730-17039752 GACCACACACCTATGGCACATGG - Intronic
1187527712 X:20069174-20069196 ATGCACACAAATAGGGCACATGG - Intronic
1188332998 X:28895967-28895989 GGTCCCACACAGATGGCACGCGG + Intronic
1188712895 X:33423571-33423593 ATGCACACACAGATCGTACGTGG - Intergenic
1188745824 X:33841944-33841966 GTGGAGATACAGATAGCACAGGG - Intergenic
1189998922 X:46665891-46665913 AAGCCCACAAAGATGGCACATGG + Intronic
1191741352 X:64438607-64438629 GTGCAGACAGAGAAGCCACATGG + Intergenic
1191825572 X:65362051-65362073 GTTCCCACACTGATGGGACATGG - Intergenic
1193283665 X:79686164-79686186 GTGCACACCCATCTGGAACAGGG + Intergenic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1199744748 X:150765405-150765427 GACAACACACAGAGGGCACAGGG - Intergenic
1199788547 X:151128050-151128072 GGGCACCCACAGAACGCACAGGG - Intergenic
1202369352 Y:24186629-24186651 GTGCACACAGACAGTGCACACGG - Intergenic
1202501433 Y:25483488-25483510 GTGCACACAGACAGTGCACACGG + Intergenic