ID: 1035684684

View in Genome Browser
Species Human (GRCh38)
Location 8:1514667-1514689
Sequence TGTCACCCCATTCTAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035684677_1035684684 18 Left 1035684677 8:1514626-1514648 CCTATGTCACTCATCCCTTCACA 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG No data
1035684680_1035684684 3 Left 1035684680 8:1514641-1514663 CCTTCACAGCTGTGTGGCCTCTC 0: 1
1: 0
2: 5
3: 26
4: 241
Right 1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG No data
1035684679_1035684684 4 Left 1035684679 8:1514640-1514662 CCCTTCACAGCTGTGTGGCCTCT 0: 1
1: 1
2: 3
3: 41
4: 381
Right 1035684684 8:1514667-1514689 TGTCACCCCATTCTAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035684684 Original CRISPR TGTCACCCCATTCTAAAGGA GGG Intronic
No off target data available for this crispr