ID: 1035684779

View in Genome Browser
Species Human (GRCh38)
Location 8:1515216-1515238
Sequence CTGAAACTCAAGTGCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035684779_1035684789 14 Left 1035684779 8:1515216-1515238 CCCACCCTGCACTTGAGTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1035684789 8:1515253-1515275 TCTTTCTTTTGAAGGGAAAAAGG No data
1035684779_1035684787 6 Left 1035684779 8:1515216-1515238 CCCACCCTGCACTTGAGTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1035684787 8:1515245-1515267 GGTGTCTTTCTTTCTTTTGAAGG No data
1035684779_1035684788 7 Left 1035684779 8:1515216-1515238 CCCACCCTGCACTTGAGTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1035684788 8:1515246-1515268 GTGTCTTTCTTTCTTTTGAAGGG No data
1035684779_1035684791 21 Left 1035684779 8:1515216-1515238 CCCACCCTGCACTTGAGTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1035684791 8:1515260-1515282 TTTGAAGGGAAAAAGGACCTGGG No data
1035684779_1035684790 20 Left 1035684779 8:1515216-1515238 CCCACCCTGCACTTGAGTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1035684790 8:1515259-1515281 TTTTGAAGGGAAAAAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035684779 Original CRISPR CTGAAACTCAAGTGCAGGGT GGG (reversed) Intronic
901281543 1:8039953-8039975 CTGAGGCTCAAGTGCAGAGGAGG + Intergenic
902403426 1:16170600-16170622 CTGAGACTCAGGGGCAGAGTTGG + Intergenic
903287983 1:22288879-22288901 CAGAAACTCAGGTTCAGAGTCGG + Intergenic
904925374 1:34043340-34043362 CTGAAAAGCTAATGCAGGGTTGG - Intronic
905596279 1:39210414-39210436 TTGAAATTCAAGTTCAGGATGGG - Intronic
905924151 1:41738066-41738088 CTGAAACTCAAATTCAGCATTGG + Intronic
905975426 1:42170804-42170826 CTGAAGCCCAAGTCCAGGCTAGG + Intergenic
906199851 1:43952941-43952963 CTGAAGCTCAAGTGCTGGGTGGG + Intronic
907297383 1:53464090-53464112 CTTAAACTCAAGTGCCAGGGGGG - Intronic
910321811 1:85954984-85955006 TTGATACGGAAGTGCAGGGTAGG + Intronic
910543344 1:88386415-88386437 GTGAAAGTCAAGTGCTGAGTGGG + Intergenic
910799289 1:91129671-91129693 CTGAAACCCAATTACAGCGTGGG - Intergenic
911045255 1:93622520-93622542 CTGAAAGGAAAGTGCAGGGCTGG + Intronic
913103140 1:115587908-115587930 AAGAAATTAAAGTGCAGGGTTGG - Intergenic
915687807 1:157652701-157652723 CTGAAACTAAATGGCAGGGTTGG + Intergenic
916387977 1:164298538-164298560 CTGGAACTCAACTGCAAGGGAGG + Intergenic
916547645 1:165821535-165821557 AGCAAACGCAAGTGCAGGGTGGG - Intronic
916658902 1:166902815-166902837 ACAAAACTGAAGTGCAGGGTAGG - Intergenic
916673100 1:167042546-167042568 TGGAAACTCAATTGGAGGGTGGG + Intergenic
917985705 1:180316083-180316105 CTTAATCTCAAGGGCAGGGCAGG - Intronic
919149040 1:193671656-193671678 CTTAAATTCAATTGCAGGGGTGG - Intergenic
922362410 1:224835514-224835536 ATGGAACTCAAGGGCAAGGTAGG - Intergenic
923654391 1:235902959-235902981 CTGAATCTAAATTGCAGGCTGGG + Intergenic
1063436299 10:6035082-6035104 GTGAGACCCTAGTGCAGGGTGGG - Intronic
1067426803 10:46216927-46216949 CTGGAACTCAAGAGGAGGATGGG + Intergenic
1068209908 10:53908033-53908055 TTGAAAATCCAGTGCAGTGTAGG - Intronic
1074431619 10:113399646-113399668 CTGCAACTCCAGTGCAGAGGAGG + Intergenic
1075485750 10:122820752-122820774 ATGAAAGTCAAGTCAAGGGTGGG + Intergenic
1083106456 11:60362929-60362951 CTGAAACTCAGGGTCAGCGTAGG + Intronic
1083596913 11:63922074-63922096 CAGGAACTCACATGCAGGGTGGG - Intergenic
1087159003 11:94931022-94931044 CAGAAATTCAAGCACAGGGTGGG + Intergenic
1089356071 11:117854737-117854759 CGGAACCTTAAGAGCAGGGTAGG + Intronic
1090018894 11:123109687-123109709 GTGAGACACAAGTCCAGGGTGGG + Intronic
1092197679 12:6559624-6559646 CTGGATCTCAAGGGAAGGGTGGG - Intronic
1092770429 12:11891698-11891720 CTGAATCTCAACTGCAGGCAGGG - Exonic
1094769317 12:33636006-33636028 CTGAAATTCAACTGCAGGTTGGG + Intergenic
1097672221 12:62554343-62554365 CAGAAACTCAAGTTCAGGGAGGG - Intronic
1100713521 12:97282311-97282333 CTGAAAGGCAAATGCAGTGTCGG + Intergenic
1102457385 12:113079113-113079135 CTGAATCTGGAGTCCAGGGTAGG - Intronic
1103920762 12:124398046-124398068 CTGAAGCTCACGTGCTGGGGAGG - Intronic
1104265367 12:127227289-127227311 CTGAAACTGAACTTCAGAGTTGG - Intergenic
1106378921 13:29216867-29216889 CTGAAACTCTTGTGCACTGTTGG - Intronic
1106940775 13:34776899-34776921 CTGAATTTCTAGTGCAGGCTGGG + Intergenic
1107576825 13:41733575-41733597 CTGAAGATCAAGTGAAAGGTAGG - Intronic
1109923655 13:69104905-69104927 CAGAAACTCAAGAGAAGGGGCGG - Intergenic
1110999972 13:82165715-82165737 TTTAATCTCAAGAGCAGGGTTGG - Intergenic
1113957206 13:114105233-114105255 CTGGAGCCCAAGGGCAGGGTGGG - Intronic
1114266918 14:21078154-21078176 CTGAAACCCACATGCAGGGATGG - Intronic
1116334563 14:43640439-43640461 CAGAAACACAACTGCAGTGTTGG + Intergenic
1118009781 14:61598669-61598691 CTGAAACTCAAGGACATGGTGGG - Intronic
1120668350 14:87334450-87334472 CTAAAACTCAAGTGGAGGCTTGG + Intergenic
1122126422 14:99581002-99581024 CAGAGAGCCAAGTGCAGGGTAGG + Intronic
1123787722 15:23689473-23689495 TTGAAATTAAAGTGCAGGCTTGG + Intergenic
1124038712 15:26080653-26080675 ATGAAACTCAAGTGGAAGGCTGG - Intergenic
1124401079 15:29348093-29348115 TTCAAACTCTAGTGCAAGGTTGG - Intronic
1126109903 15:45169017-45169039 CTGAAACTCAAGCACAGGCAAGG + Intronic
1127971187 15:63963076-63963098 CTGAGATTCAATTGCAAGGTGGG - Intronic
1129696339 15:77742462-77742484 GGGAAACTAAGGTGCAGGGTGGG + Intronic
1131456252 15:92584783-92584805 CTGAGATTCAAGTGGAAGGTGGG + Intergenic
1132464642 16:72048-72070 CTGAAACTCCAGCCCAGGGCGGG - Intronic
1134164604 16:11920054-11920076 CAGGAACTCAAGTGTAGGGAGGG - Intergenic
1134742347 16:16559242-16559264 CTGAAACTCAAGTTCTGTTTGGG + Intergenic
1134925218 16:18153217-18153239 CTGAAACTCAAGTTCTGTTTGGG - Intergenic
1138799385 16:60008719-60008741 CAGAAATTCAAGTTCAGAGTGGG - Intergenic
1141301665 16:82821776-82821798 CTGAACCTCAAATGAAGTGTAGG + Intronic
1141965635 16:87440909-87440931 CTGAAAATGAAGGGCAGGGCTGG - Intronic
1144310466 17:14009332-14009354 CTGAAACTAAAGAACATGGTTGG - Intergenic
1144369288 17:14574751-14574773 CTGGAGCTCAAGGGAAGGGTTGG - Intergenic
1145779538 17:27553194-27553216 GTGAAAGTCAAGTGCGGGGGTGG + Intronic
1147649569 17:42054199-42054221 CTTACACTGAAGTGAAGGGTTGG + Intronic
1148151525 17:45399158-45399180 CTGAACCAAAAGGGCAGGGTTGG - Intronic
1148546150 17:48520566-48520588 CTGGAACTCAAGGGCAAGGATGG - Intergenic
1148935600 17:51162504-51162526 CAGAAGTTCAAGTCCAGGGTGGG + Intronic
1149318346 17:55459506-55459528 CTGAATCTCAAGGTGAGGGTAGG + Intergenic
1150191725 17:63248359-63248381 CTGAACGTCAAGGGCAGGATGGG + Intronic
1151517093 17:74603506-74603528 CTGAGACTCAAGAGAAGGGCTGG + Intergenic
1151551767 17:74826519-74826541 CAGAAACCCAAGTGCATGGTGGG + Intronic
1157726451 18:49967988-49968010 CTGAAACTCCAATGCAGGACAGG + Intronic
1157970066 18:52256998-52257020 CTGAAACTCAACTGAAAGCTTGG + Intergenic
1158490380 18:57905028-57905050 CTGAAACTGGGGGGCAGGGTGGG - Intergenic
1160515438 18:79476916-79476938 CAGAAACTCCAGTGAAGAGTCGG + Intronic
1161952773 19:7477074-7477096 GTGAAACCCATGGGCAGGGTGGG - Exonic
1162751452 19:12832532-12832554 CTGAAATCCAAGCGCAGGGTCGG - Intronic
1163101646 19:15100930-15100952 CTGAAACTGAGGTGCAGGAGGGG - Intergenic
1163546567 19:17944290-17944312 CTGAGATTCCAGTTCAGGGTGGG + Intergenic
1165800782 19:38548331-38548353 CTGAAACTCAAGGACATTGTGGG + Exonic
1165958396 19:39515825-39515847 CTGAAGGTGAAGTCCAGGGTGGG - Exonic
1166104361 19:40590103-40590125 CTGGAACTCAAAAGCAGGCTAGG + Intronic
1166539801 19:43597513-43597535 CTGAAAGTCTAGGGCAGAGTTGG - Intronic
1167782360 19:51607192-51607214 CTGAAACTCACCTGCAAGGGGGG + Intergenic
1168033224 19:53698059-53698081 CTGGAACTCAAGTGAACGCTTGG + Intergenic
1168034199 19:53705929-53705951 CTGGAACTCAAGTGAACGCTTGG + Intergenic
1168035520 19:53716270-53716292 CTGGAACTCAAGTGCACCCTTGG + Intergenic
925201775 2:1972977-1972999 CTGATGCTAAATTGCAGGGTTGG + Intronic
925478944 2:4248698-4248720 CTCCAACTCAAGGGCAGGGCTGG + Intergenic
925873127 2:8287863-8287885 CTGAGACTCAAGTCCTGGTTAGG - Intergenic
927131860 2:20066734-20066756 ATGAAACTGAAGGGCAGTGTGGG + Intergenic
928776174 2:34766659-34766681 CTGATCCTGAAGTTCAGGGTAGG + Intergenic
935673929 2:105578149-105578171 CTGAAGCTCAATAGCAGAGTAGG + Intergenic
938250424 2:129811586-129811608 CTGTAACTCAATTGCAAGGAGGG + Intergenic
941002472 2:160216512-160216534 CTGAAGCCCAAGTAAAGGGTGGG + Intronic
941108424 2:161390024-161390046 ATGAAAATAAAATGCAGGGTCGG - Intronic
941569458 2:167152079-167152101 CTGAAACACAAGTACACAGTTGG - Intronic
942572331 2:177326934-177326956 CTGAAGCTCAAGAGAAGGGTTGG + Intronic
944452113 2:199853695-199853717 TTGAGAGGCAAGTGCAGGGTCGG - Intergenic
947959210 2:234221008-234221030 TTGAAACTCAAGGGCAAGGAAGG + Intergenic
1169888844 20:10432195-10432217 CAGGAACTCTAGTGCTGGGTTGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173594753 20:44251506-44251528 TTGAAAGGCAAGGGCAGGGTGGG - Intronic
1178896790 21:36565372-36565394 CTGCAATACAATTGCAGGGTTGG - Intronic
1178976314 21:37224140-37224162 CAGAAACCCATGTGCAGGGTGGG - Exonic
1181467192 22:23116589-23116611 CTGCAACTACAGTGCAGGATGGG + Intronic
1183473996 22:38026005-38026027 CTGAAACCCAAGTGCACGAGGGG - Intronic
1184722385 22:46322476-46322498 CTGATACTCAAGTGCACACTGGG + Intronic
1184751326 22:46488108-46488130 CTGAAACTGAGGTGCAGGGCAGG - Intronic
1185341399 22:50292918-50292940 CTGAACCCCCAGTGCAGGGAGGG - Intronic
949549359 3:5099440-5099462 CTGAAATTAAAATGCAGGCTGGG - Intergenic
952920518 3:38280979-38281001 GTGAGACTGAAGAGCAGGGTGGG - Intergenic
955004056 3:54953038-54953060 CAGAGACTCAACTGCAGGGGAGG + Intronic
958879932 3:99658264-99658286 CTGTAACTGTAGTGCAGGGTGGG - Intronic
960547550 3:118933906-118933928 TTGAAGCTCACGTACAGGGTTGG - Intronic
965478117 3:169183460-169183482 TTAAAAGTCAAGTGCAGGTTGGG - Intronic
966208722 3:177430950-177430972 CTGTAACTCAACTGGAAGGTAGG - Intergenic
967229001 3:187319872-187319894 CTGAAACTCTCCTGCAGGGGAGG + Intergenic
968971266 4:3796557-3796579 CTGACACAGAAGTTCAGGGTAGG + Intergenic
971796975 4:31240781-31240803 CTGAAAGTCAAAAGCAGGGAAGG - Intergenic
974161641 4:58149170-58149192 TTGAAACTCACGTGCATTGTGGG + Intergenic
974393290 4:61301925-61301947 CGGAAACTTAAGATCAGGGTTGG + Intronic
982530454 4:156535010-156535032 CTGAAACTAAAGTCCAGCTTTGG - Intergenic
983872490 4:172838198-172838220 CTGGATCACAAGTGCAGTGTGGG - Intronic
985963507 5:3321881-3321903 CGGAAACTGAAGTGCTGGGCAGG + Intergenic
986682703 5:10248693-10248715 CTGAAACTCAAGAACAGACTTGG - Intronic
987910665 5:24139822-24139844 CTGAAACTCAACTGAAAGGATGG + Intronic
988364157 5:30274114-30274136 CAAAAACTCAACTGCAGGGAGGG + Intergenic
991624517 5:68586173-68586195 ATGAAACTAAAGTGGAAGGTAGG + Intergenic
997880032 5:137581292-137581314 CTGAAACTCAAGAGCTGGGCTGG + Intronic
1001952289 5:175824608-175824630 CTGAAAGTCAAGAGGAGGGCAGG + Intronic
1002169011 5:177364974-177364996 CTCAAACTTCAGTGCAGAGTGGG - Intronic
1002772843 6:304193-304215 CTGAGCCCCAAGTCCAGGGTTGG - Intronic
1005926709 6:30451237-30451259 TTGAAACTCAACTCCTGGGTGGG + Intergenic
1005928442 6:30463956-30463978 TTGAAACTCAACTCCCGGGTGGG + Intergenic
1007320734 6:41027390-41027412 CTGAAACACAGGTGCAGAGCGGG + Exonic
1010926334 6:81751031-81751053 CTTGAACTAAAGTGGAGGGTGGG + Intronic
1015272903 6:131355536-131355558 CTGGAACTCAAGTCCATGGTTGG - Intergenic
1015487266 6:133787122-133787144 CTGAGCCTCAAGTGCAGGACGGG - Intergenic
1017293966 6:152773124-152773146 CTGAAACTCCAGTGAGGGCTTGG - Intergenic
1018092354 6:160356099-160356121 CTGAAAGCCAATTCCAGGGTTGG - Intronic
1018598192 6:165507108-165507130 ATGAAACACAAGTACAGGGTAGG - Intronic
1018962276 6:168457426-168457448 CTGCAGCTCCAGTGCAGGGTCGG - Intronic
1018988159 6:168653562-168653584 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988210 6:168653849-168653871 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988217 6:168653890-168653912 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988224 6:168653931-168653953 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988231 6:168653972-168653994 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988238 6:168654013-168654035 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988266 6:168654177-168654199 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988273 6:168654218-168654240 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988332 6:168654546-168654568 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988339 6:168654587-168654609 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988346 6:168654628-168654650 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988353 6:168654669-168654691 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988360 6:168654710-168654732 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988367 6:168654751-168654773 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988374 6:168654792-168654814 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988381 6:168654833-168654855 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988388 6:168654874-168654896 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988395 6:168654915-168654937 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988402 6:168654956-168654978 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988409 6:168654997-168655019 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988416 6:168655038-168655060 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988423 6:168655079-168655101 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988430 6:168655120-168655142 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988437 6:168655161-168655183 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988444 6:168655202-168655224 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1018988451 6:168655243-168655265 TTGGAGCTCAGGTGCAGGGTTGG - Intronic
1019321716 7:419043-419065 CTGAAGCTCAAGTCCAGGCCTGG + Intergenic
1019424071 7:965028-965050 CAGAAACTCAAAGGCAGCGTTGG + Intronic
1020789560 7:12609921-12609943 CTGTTTATCAAGTGCAGGGTTGG + Intronic
1021806431 7:24361497-24361519 CTGAAGCTGAAGTCCAGGGGTGG - Intergenic
1022711541 7:32855397-32855419 CTGAGACTCAAGTTCAGGCAGGG + Intergenic
1022913116 7:34919562-34919584 CTGAGACTCAAGTTCAGGCAGGG - Intergenic
1023557508 7:41438461-41438483 CTGAAACTCAAGAGGAGTTTTGG + Intergenic
1025062362 7:55821341-55821363 CTGAAGCTTCAGGGCAGGGTGGG + Intronic
1025173459 7:56782484-56782506 TTGAAAATCAAGTCCACGGTCGG - Intergenic
1025698643 7:63795687-63795709 TTGAAAATCAAGTCCACGGTCGG + Intergenic
1026673723 7:72412028-72412050 CAGAAACTAAAGAGCATGGTGGG - Intronic
1028758955 7:94473052-94473074 CTGAAACTCAAGCCCAAGTTTGG - Intergenic
1034099351 7:148437759-148437781 CTGATACTGAAGTGCTGGGAAGG - Intergenic
1035684779 8:1515216-1515238 CTGAAACTCAAGTGCAGGGTGGG - Intronic
1036568662 8:9960357-9960379 CGGAACCTCAAGTGCTGGATGGG + Intergenic
1039113857 8:34070515-34070537 CTTAAACACAAGAGCAGGGTTGG + Intergenic
1039328678 8:36512991-36513013 GTGAAAATAAAGTGCAGAGTGGG - Intergenic
1041626489 8:60034713-60034735 CTGAAACACAAGTGGAGGGCTGG - Intergenic
1043502210 8:80869551-80869573 CTGAAACCCAAGTAAAGGGCTGG - Intronic
1048206140 8:132416872-132416894 CTGAAACTGAAAGGCAGGGCAGG + Intronic
1048822167 8:138390582-138390604 CTGTATCTCCAGTGCAGAGTAGG + Intronic
1048907826 8:139105343-139105365 CTGGAACTCAAGAGCAAGATGGG - Intergenic
1048937433 8:139368716-139368738 GAGAAACTGAAGTGCAGTGTGGG + Intergenic
1053411618 9:37919576-37919598 CAGAAACTCAAGGAGAGGGTGGG + Exonic
1055147035 9:72948400-72948422 ATGAAACTGAAGTACAGGCTGGG - Intronic
1057198074 9:93126218-93126240 CAAAAACCAAAGTGCAGGGTGGG + Intronic
1057332046 9:94124393-94124415 CTGAAACCCTAGTGCACTGTTGG - Intergenic
1057699713 9:97354991-97355013 GTGAAAATCAAGTGCCAGGTAGG + Exonic
1060191355 9:121595176-121595198 CGGAAACTGAAGTTCAGAGTAGG + Intronic
1060877149 9:127091633-127091655 GTCAAACCCAGGTGCAGGGTAGG - Intronic
1062143186 9:134971496-134971518 CTGCATCTGAAGGGCAGGGTGGG + Intergenic
1186196635 X:7116133-7116155 CAGAAGCTCAAATGCAGGTTGGG + Intronic
1188149796 X:26658115-26658137 CTGGAATGCAAGTGCAAGGTTGG - Intergenic
1189047068 X:37604671-37604693 CTCAAAATCAAGAGCAGGGATGG + Intronic
1195390537 X:104357632-104357654 CAGAAACAAAAGTGTAGGGTTGG + Intergenic
1196821057 X:119701077-119701099 CTGGAACTCAAGAGAAGGCTGGG + Intergenic
1200958819 Y:8978252-8978274 CTGAAAGTCAAGTACATGGGTGG - Intergenic