ID: 1035687555

View in Genome Browser
Species Human (GRCh38)
Location 8:1536779-1536801
Sequence GGAAATAAAAATAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1817
Summary {0: 1, 1: 1, 2: 9, 3: 159, 4: 1647}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035687555_1035687561 28 Left 1035687555 8:1536779-1536801 CCCACCTCTTTATTTTTATTTCC 0: 1
1: 1
2: 9
3: 159
4: 1647
Right 1035687561 8:1536830-1536852 AACTAATTCCTCCCTGTAGGAGG No data
1035687555_1035687560 25 Left 1035687555 8:1536779-1536801 CCCACCTCTTTATTTTTATTTCC 0: 1
1: 1
2: 9
3: 159
4: 1647
Right 1035687560 8:1536827-1536849 TTGAACTAATTCCTCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035687555 Original CRISPR GGAAATAAAAATAAAGAGGT GGG (reversed) Intronic
901283184 1:8055741-8055763 GGAAGAAAAGAAAAAGAGGTCGG - Intergenic
901335507 1:8445679-8445701 GAACATAAAAAAAAAAAGGTGGG - Intronic
901722112 1:11207402-11207424 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
901919632 1:12526911-12526933 AAAAATAAAAATAAATAGGCTGG + Intergenic
901961945 1:12833849-12833871 GGAAAAAAAAAAAAAAAGGCCGG + Intergenic
901983915 1:13058504-13058526 GGAAAAAAAAAAAAAAAGGCCGG + Intergenic
902388530 1:16089480-16089502 GGAAAGAAAAAGAAAGAAATTGG + Intergenic
902666289 1:17941138-17941160 AAAAAGCAAAATAAAGAGGTGGG - Intergenic
902959104 1:19949565-19949587 AAAAATAAAAATAAAAAGCTGGG + Intergenic
903426911 1:23260531-23260553 GGAAAAAAAAAAAAAAAGGGAGG - Intergenic
903428156 1:23270238-23270260 GCAATTAAAAATAAAGGGGGAGG + Intergenic
903616865 1:24665928-24665950 GGCAAAAAAAATTAAGAGCTTGG + Intronic
903641549 1:24863430-24863452 GGAAAAGACATTAAAGAGGTTGG + Intergenic
903641555 1:24863469-24863491 GGAAAAGACATTAAAGAGGTTGG + Intergenic
903724795 1:25431907-25431929 GAAAAAAAAAAAAAAGAGTTTGG - Intronic
904136092 1:28313716-28313738 TAAAATAAAAATAAAAAGGTGGG + Intergenic
904141102 1:28353842-28353864 GGAAAAAAAAATAAAAAAGCTGG - Intergenic
904535604 1:31197540-31197562 GGAAAAAAAAAAAAAAAGGCCGG - Intronic
904643385 1:31947323-31947345 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
905063880 1:35163365-35163387 AGAAAAAAAAAAAAAAAGGTCGG + Intergenic
905597180 1:39217885-39217907 AAAAAAAAAAAAAAAGAGGTCGG + Intronic
905603382 1:39273379-39273401 AGAAATGATAAGAAAGAGGTTGG + Intronic
905713912 1:40131807-40131829 GTAAAAAAAAAAAAAAAGGTCGG - Intergenic
905957774 1:42013505-42013527 GTAAAGATAAATAAACAGGTAGG - Intronic
906028297 1:42694943-42694965 GTTGATAAAAATAAAGAGTTGGG + Intronic
906354822 1:45095419-45095441 AAAAATAAAAATAAAGAGCCAGG - Intronic
906865599 1:49415570-49415592 AGAAATAAAACTAGAAAGGTAGG + Intronic
906987481 1:50700146-50700168 AGAAATAAAAAAAAAAAGGGGGG - Intronic
907069366 1:51519510-51519532 GGACATAAAATTAAAGCGGACGG + Intergenic
907479122 1:54732033-54732055 AGAAAAAAAAATATAGAGGCTGG + Intronic
907481191 1:54746573-54746595 TTTAATAAAAATAAAGAGGCAGG - Intergenic
907572255 1:55494044-55494066 AATAATAATAATAAAGAGGTAGG - Intergenic
907592204 1:55685968-55685990 TGAAATGAAAACAAAAAGGTAGG - Intergenic
907979150 1:59463682-59463704 GGAAAAAAAAAAAAAAAGGCAGG + Intronic
908136396 1:61137946-61137968 AGAAAAAAAAAAAAAGAGGTGGG - Intronic
908144620 1:61226643-61226665 AAAAATAAAAATAAAAAGATGGG - Intronic
908532473 1:65046865-65046887 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
908676153 1:66606373-66606395 AGAAATAGAAATAAAGAGCTTGG - Intronic
908680199 1:66652331-66652353 GAAAATAAAAATAGCGAGGGAGG + Intronic
908880661 1:68728796-68728818 GAAAATAAAAAGAAAGATGCTGG - Intergenic
909074125 1:71032725-71032747 ATAAATAAATATAAAAAGGTAGG - Intronic
909201621 1:72696382-72696404 GTAAAGAAGAATAAAGAAGTTGG + Intergenic
909365885 1:74821316-74821338 GTAAATAATAATAAAGATGGGGG + Intergenic
909497911 1:76300081-76300103 GGACAGAAAAATATGGAGGTGGG + Intronic
909663279 1:78107111-78107133 GGAAAGAAAAGGAAAAAGGTAGG - Intronic
909681951 1:78301485-78301507 GGAAAGAATACTAAAGAGGAGGG - Intergenic
909861433 1:80610592-80610614 GGAAAAAAAAATCAAAAAGTGGG - Intergenic
909940570 1:81606634-81606656 GGAAAGAAAAATAAAGACACAGG - Intronic
910157920 1:84241216-84241238 GGAAAAAAAAAAATAGATGTTGG - Intergenic
910217980 1:84861674-84861696 GGAAATGAAACTCAAGAGCTAGG - Intronic
910606409 1:89089910-89089932 GGAAATATAAAATAAGTGGTAGG + Intergenic
910658063 1:89638773-89638795 GGAAATAAAAGGATACAGGTAGG - Intronic
910689057 1:89947683-89947705 GGAGAAAAAAATAAAAGGGTGGG - Intergenic
910767097 1:90792708-90792730 TGTATTAAAAAAAAAGAGGTTGG - Intergenic
910843151 1:91580352-91580374 GGCAACAAAAATAAACAAGTGGG + Intergenic
911135310 1:94433150-94433172 GGAAAAAAAAAAAAAAAGGCTGG - Intronic
911197013 1:95004800-95004822 AAAAATAAAAATAAAAAGGCGGG - Intronic
911201923 1:95053180-95053202 AAAAGTGAAAATAAAGAGGTGGG + Intronic
911246516 1:95524518-95524540 GGTAATAGTATTAAAGAGGTGGG - Intergenic
911263269 1:95712561-95712583 GAAAATAGAAAGAAAGAGGTGGG - Intergenic
911326405 1:96474208-96474230 GAAAATAGAAATAAAAAGGAGGG + Intergenic
911488603 1:98533716-98533738 AAAAATAAAAAAAAAAAGGTTGG + Intergenic
911633485 1:100208600-100208622 GTAAATGAAAATGAAGAGGCTGG + Intronic
911710542 1:101066677-101066699 GGAAATGAGATTAGAGAGGTGGG + Intergenic
911745946 1:101442184-101442206 AGAAAAAAAAAGAAAGAGGCCGG - Intergenic
911828912 1:102525367-102525389 GAAAATAAAAATACACAAGTTGG + Intergenic
911855034 1:102865753-102865775 GGTAATGAAGATAAAGAGGAAGG + Intergenic
912039253 1:105365712-105365734 AGAAAGAAAAATAAAGATTTTGG + Intergenic
912106471 1:106283180-106283202 AGAAATAGAGATAAAGAGATCGG + Intergenic
912203703 1:107486715-107486737 GAAAAAAAAAAAAAAAAGGTGGG + Intergenic
912325644 1:108758262-108758284 GGAAAAAAAAAAAAAGAGTAAGG - Intronic
912372381 1:109184073-109184095 TAAAATAATAATAAAGAGGCCGG + Intronic
912878107 1:113383532-113383554 GGAAATGAAATCAGAGAGGTAGG - Intergenic
913193092 1:116430247-116430269 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
913230175 1:116735028-116735050 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
913367338 1:118054711-118054733 GAAAAGAAAAATAAATAGATAGG - Intronic
913415989 1:118608042-118608064 AGAAAGAAAAATAAAGCTGTGGG - Intergenic
914048178 1:144107675-144107697 GGAAGAAAAAATAATGAGGCAGG + Intergenic
914131006 1:144857773-144857795 GGAAGAAAAAATAATGAGGCAGG - Intergenic
914396365 1:147272902-147272924 GGAAAAAAAAAAAAAAAGGCCGG + Intronic
914685456 1:149974844-149974866 AGAAAGAAAAAGAAAGAGGCTGG - Intronic
914688651 1:150005528-150005550 GGTAATGATTATAAAGAGGTGGG + Intronic
914805055 1:150985520-150985542 GGAAAGCAAGAAAAAGAGGTAGG - Intronic
915150944 1:153830769-153830791 AAAAATAAAAATAAAAAGGCCGG - Intronic
915155571 1:153873255-153873277 GGAAATAAATATGAATTGGTAGG - Intronic
915157658 1:153891584-153891606 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
915206804 1:154276051-154276073 AGAAAAAAAAAAAAAGAGGCCGG + Intergenic
915234028 1:154467167-154467189 GGAACTAAATAAAAAGAGGAAGG - Exonic
915243095 1:154537740-154537762 AGAAACAAAAATACAAAGGTTGG - Intronic
915387120 1:155505110-155505132 GAAAATATAAATAATGAGGCCGG - Intronic
915648261 1:157289290-157289312 GGAAATAAAAGAAAGGAGTTTGG + Intergenic
915649343 1:157296537-157296559 GGAAATAAAAAAAAAAAAGCCGG + Intergenic
915697298 1:157756679-157756701 GAAAAAAAAAAAAAAAAGGTTGG + Intronic
916161919 1:161925377-161925399 GCAAATAAAATTAAAAAGCTTGG - Intronic
916200295 1:162264810-162264832 TGAAAAAAAAAAAAAAAGGTCGG - Intronic
916492539 1:165314602-165314624 GGTAATAAAAAAAAAGATATTGG - Intronic
916756832 1:167778786-167778808 GGAAATAAAAAAAAATTGGATGG + Intronic
917041809 1:170813061-170813083 GGAAAGAAAAAAAAAGGGGGTGG + Intergenic
917069758 1:171137518-171137540 TGAAGTAAAAAGAAAGGGGTAGG - Intergenic
917095034 1:171391401-171391423 GGAAATAAGGATAAAGATGGAGG - Intergenic
917149970 1:171932466-171932488 AGAAATACAAAGAAAAAGGTAGG - Intronic
917282275 1:173389411-173389433 GGAAAAAGAAATAAAGAGAATGG - Intergenic
917445610 1:175103872-175103894 GCAAAAAAACACAAAGAGGTAGG - Intronic
917567427 1:176227111-176227133 GAGAATAACAATAAAGAGATAGG + Intergenic
917572411 1:176281912-176281934 GGAAAGAGAAAGAAAGAGGAGGG - Intergenic
917871399 1:179245285-179245307 AAAAAAAAAAAAAAAGAGGTCGG + Intergenic
917885680 1:179382068-179382090 AAAAATAAAAATAAAGGGCTGGG - Intronic
917892762 1:179455294-179455316 GTAAAAAAAAAAAAAGAGGCTGG + Intronic
918250078 1:182695491-182695513 TTAAAAAAAAATTAAGAGGTAGG + Intergenic
918342630 1:183580159-183580181 GGAAATAAAAGAAGAGAGCTTGG + Intronic
918346245 1:183609908-183609930 AGAACTAAAAATAGAGAGTTTGG - Intergenic
918351898 1:183664859-183664881 GGAAAAAAAAGTATACAGGTTGG - Intronic
918445609 1:184614008-184614030 AGAAATAAAAATAAAGAGATGGG + Intronic
918546750 1:185693354-185693376 GGAAATAAGACAAAAGAGTTAGG - Intergenic
918557328 1:185818344-185818366 GGAAAAAAAAATAAATTGATAGG - Intronic
918749183 1:188249986-188250008 GGAAAAAAAAACAAAAAGATGGG - Intergenic
918760234 1:188395055-188395077 GGAAATTAGAAAAAATAGGTAGG + Intergenic
918936952 1:190933005-190933027 GGAAAAAAAAATCAAAACGTGGG + Intergenic
918939002 1:190965603-190965625 GAAAATAATGATAAATAGGTAGG - Intergenic
919157371 1:193783723-193783745 GGATATGAAAATAAAGAGATGGG - Intergenic
919186481 1:194157849-194157871 GGAAAAAAAAATCAAAAAGTGGG - Intergenic
919267355 1:195286767-195286789 GGAAATGAAAACAAAATGGTGGG + Intergenic
919431744 1:197502642-197502664 GGAAAGAAAGAGAAAGAGGAAGG + Intergenic
919472021 1:197990155-197990177 GGAAAAAAAAAAAAAGAAGAAGG + Intergenic
919503742 1:198371541-198371563 TGTAATAAAAAAAAAGAGGAAGG + Intergenic
919685692 1:200481653-200481675 GGAGATGAGAATAAAGAGGTGGG + Intergenic
920005239 1:202828489-202828511 CGAAAAAAAAAAAAAGAGGCCGG + Intergenic
920023474 1:202974300-202974322 GGAAATAAAAATAACAAAGGAGG + Intergenic
920115236 1:203616031-203616053 AAAAATAAAAATAAATAGCTGGG + Intergenic
920239830 1:204538355-204538377 GAGATTAAAAATAAAAAGGTTGG - Intronic
920296277 1:204959126-204959148 AGAAAGAAAAAGAAAGAGGGAGG - Intronic
920663661 1:207942524-207942546 TGAAAGAAAAAGAAAGAGGAAGG - Intergenic
921071136 1:211658749-211658771 GGAAAGAAAAAAAAAGAAATAGG + Intronic
921429598 1:215049941-215049963 ACAAATAAGAATAAAGTGGTAGG - Intronic
921503000 1:215929607-215929629 GAAAATAGAACAAAAGAGGTAGG + Intronic
921879425 1:220237532-220237554 AGAAATTAAAATAATGAGTTAGG + Intronic
921947016 1:220893077-220893099 AGAAATAAGAGGAAAGAGGTGGG - Intergenic
922165646 1:223113628-223113650 TAAAATAAAAATATAGAGATGGG + Intronic
922171699 1:223160959-223160981 GTAAATAAAAATGAATAGCTTGG + Intergenic
922447809 1:225712245-225712267 GGAAAGGAAAATAAAAGGGTAGG - Intergenic
922522384 1:226266578-226266600 AGAAATAAAAAAAAAGGGGGGGG + Intronic
922609679 1:226916298-226916320 GGAAAAAAAAATCATGAGGCTGG - Intronic
923346496 1:233058368-233058390 GGAAATAAAAGGACAAAGGTAGG - Intronic
923459185 1:234193574-234193596 AAAAACAAAAATAAATAGGTGGG + Intronic
923463114 1:234224361-234224383 GTAATTAAAATTAAAGAGGCTGG - Intronic
923872401 1:238010191-238010213 GAAACTAAAAATAAAATGGTTGG - Intergenic
924122608 1:240817596-240817618 AAAAATAAAAATAAAAAGGACGG - Intronic
924540612 1:244977532-244977554 ATAAATAATAATAAAGAAGTCGG + Intronic
924568703 1:245219120-245219142 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
1062870485 10:898702-898724 GGAAAGAAAAAGAATGAGTTTGG + Intronic
1063044216 10:2375601-2375623 GAAAATAAAAGAAAAGAGGGAGG + Intergenic
1063140047 10:3248035-3248057 GGAAAAAAAAATCCAGATGTGGG - Intergenic
1063466694 10:6250572-6250594 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1063923332 10:10952675-10952697 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1064034589 10:11905000-11905022 GAAAAAAAAAAAAAATAGGTTGG + Intergenic
1064226290 10:13488646-13488668 GAAAATAAAAAAAAATAGCTAGG - Intronic
1064323811 10:14330306-14330328 GGAAAAAAAAAAAAAGAAGAAGG + Intronic
1064340267 10:14479251-14479273 GAAAAGAAAAAAAAAGAGGTGGG + Intergenic
1064692097 10:17928823-17928845 GGAAAAAAAAAAAAAGAGCCAGG - Intergenic
1064734587 10:18368460-18368482 GGCAATAAAAATAGAGAGCAAGG - Intronic
1064807752 10:19156397-19156419 TTTAATGAAAATAAAGAGGTGGG - Intronic
1065105308 10:22377741-22377763 GGAAATAAAAATAAAACATTGGG - Intronic
1065149697 10:22810177-22810199 GAAAACAAAAATAAATAGATGGG - Intergenic
1065710705 10:28514782-28514804 GGAACTCAAAAAAAAGATGTGGG + Intergenic
1065739813 10:28786897-28786919 GGAAATAAAAATAAACACAGGGG + Intergenic
1065850687 10:29785174-29785196 GAAAATTAAAATAAATAGGTGGG + Intergenic
1065855492 10:29826921-29826943 GAAAAAAAAAAAAAAAAGGTGGG + Intergenic
1066129407 10:32377686-32377708 AGGAAGAAAAAAAAAGAGGTGGG - Intronic
1066526549 10:36285312-36285334 AGAAATTAAAATAAATAGGATGG + Intergenic
1066639899 10:37545475-37545497 ATAAATAAAAATAAAGATTTTGG - Intergenic
1066960317 10:42216733-42216755 AAAAATAAAAATAAAGACTTTGG + Intergenic
1066991318 10:42516832-42516854 GGGAATCAAAAGAAAGAGGAAGG + Intergenic
1067121665 10:43477653-43477675 GAAAAAAAAAAAAATGAGGTCGG + Intronic
1067479643 10:46586544-46586566 TCAAAAAAAAAAAAAGAGGTTGG + Intronic
1067615093 10:47755253-47755275 TCAAAAAAAAAAAAAGAGGTTGG - Intergenic
1068071252 10:52199083-52199105 GGAAAAAAAAAGAAAGAGCAAGG - Intronic
1068382115 10:56269134-56269156 AGAAATAAAAATAGAGAAGGGGG + Intergenic
1068467600 10:57415234-57415256 GGAATTTAAAATAAAAAAGTGGG + Intergenic
1068533457 10:58213971-58213993 GGAAATAGAAATAACGAGTTTGG + Intronic
1068577454 10:58700173-58700195 GGAAATAAACACAGTGAGGTGGG + Intronic
1068723367 10:60272771-60272793 GGAATTAAAAAAAAAAAGGTGGG - Intronic
1068914873 10:62419493-62419515 GGAAAAAAAAAAAAAAAGGACGG + Intronic
1068948633 10:62755258-62755280 GGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1069108169 10:64409417-64409439 AGAAAAAAAAAGAAAGAGGAAGG + Intergenic
1069116819 10:64517509-64517531 AGAAATAAAAAGAAAGTGGAGGG - Intergenic
1069431452 10:68338878-68338900 AGAAATTAAAATTAAGATGTTGG + Intronic
1069471835 10:68699445-68699467 GTTTATAAATATAAAGAGGTAGG + Intergenic
1070000015 10:72369307-72369329 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1070247540 10:74746565-74746587 AAAAATAAAAATAAATAGCTGGG - Intergenic
1070272291 10:74967968-74967990 GGAAGTAATAAAAAAGAGGGGGG + Intronic
1070273052 10:74976541-74976563 GGAAATAAATAATAAAAGGTGGG - Intronic
1070316235 10:75315441-75315463 GGAACTTAAAATATAGGGGTTGG + Intergenic
1071007694 10:80901674-80901696 GGAAATAAACATAAAAGTGTAGG + Intergenic
1071079735 10:81796526-81796548 GGAAATAGATATAAAGGGCTTGG - Intergenic
1071138477 10:82479500-82479522 GGAAAAAAAAAAAAACAGCTGGG + Intronic
1071216480 10:83408484-83408506 GGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1071490599 10:86134000-86134022 GGAAACAAAAGGAAAGAGGGAGG + Intronic
1071584793 10:86809588-86809610 AAAAAAAAAAAAAAAGAGGTCGG - Intronic
1071948458 10:90675277-90675299 AGAAAAAAAAATAATGAGTTTGG - Intergenic
1072053248 10:91727530-91727552 GGAGAGAAAAATAAACAGTTTGG - Intergenic
1073221167 10:101875518-101875540 GGAAATGAAAATAGAAAGGGGGG - Intronic
1073301173 10:102471761-102471783 AGAAAAAAAAAAAAAGAGCTGGG + Intronic
1073356802 10:102861418-102861440 AGAAAAAAAAAAAAAGAGGCTGG + Intronic
1073715451 10:106101432-106101454 GGCAATAAAAATTAGGAGGTGGG + Intergenic
1073722567 10:106189872-106189894 ACAAATAAAAATAAAGAGATAGG - Intergenic
1073753763 10:106559102-106559124 GAAAAAAAAAAAAAAGAAGTGGG - Intergenic
1073753868 10:106559983-106560005 GGATATAAAGCTAAAGAGATGGG - Intergenic
1074049218 10:109867228-109867250 GGAAATGAAAACACATAGGTGGG - Intronic
1074091206 10:110257893-110257915 GGAAAAAAAAATAAGGGGGGAGG + Intronic
1074148664 10:110739407-110739429 GAATATAAACATTAAGAGGTTGG - Intronic
1074321402 10:112406558-112406580 GGAAATAAAACTGGAAAGGTAGG - Intronic
1074460003 10:113628166-113628188 TAAAATAAAAATGAAGAGGTTGG - Intronic
1074508055 10:114088563-114088585 TGAAAAAAAAAAAAATAGGTGGG - Intergenic
1074953780 10:118367470-118367492 AGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1075003259 10:118813250-118813272 AGAAATAAAAATAAATAAGTAGG + Intergenic
1075130936 10:119739022-119739044 GAAAAAAAAAAAAATGAGGTGGG + Intronic
1075554134 10:123417517-123417539 GGAAAGAAAAATTGAGAGGGTGG - Intergenic
1075749753 10:124756464-124756486 GGAAATAAACTTAAAAAGATAGG - Intronic
1075950522 10:126473632-126473654 AAAAATAAAAATCCAGAGGTGGG - Intronic
1077708113 11:4507982-4508004 GAAAAAAAAAATCAAGAAGTGGG + Intergenic
1077877079 11:6318057-6318079 GAAAATAATTATAAAGAGCTTGG + Intergenic
1078241400 11:9533985-9534007 GGAAAAAAAAAAAAGGAGGGTGG - Intergenic
1078407005 11:11079167-11079189 GGCAATAAGAGTGAAGAGGTGGG + Intergenic
1078489230 11:11753982-11754004 GGAAATGCAAATCAAGATGTGGG + Intergenic
1078497019 11:11827672-11827694 TAAAATAAAAATAAATAGCTGGG - Intergenic
1079043026 11:17076557-17076579 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1079073759 11:17370424-17370446 TGAAATGAAAGTAAAGAGTTTGG - Intronic
1079146599 11:17857844-17857866 GGAAATAGAGATAAAGGTGTGGG - Intronic
1079535820 11:21514302-21514324 GCATATAAAAATGAAGATGTTGG + Intronic
1079603241 11:22337284-22337306 AGAGATAAAGAAAAAGAGGTGGG - Intergenic
1079631816 11:22686920-22686942 AGAAATAAAAAAATAGAGGGAGG - Intronic
1080024141 11:27596149-27596171 GGAAAAAAAAAAAAAAAGGTGGG + Intergenic
1080122547 11:28693938-28693960 TGTAATAAAAAAAAGGAGGTCGG - Intergenic
1080164659 11:29222777-29222799 GGAAAGAAAAAAAAAAAAGTAGG - Intergenic
1080294740 11:30713699-30713721 GCAAATGAAAGTAAAGAGTTAGG - Intergenic
1080429412 11:32184716-32184738 GGAAAAAAAAATGAAGTGGAGGG - Intergenic
1080552285 11:33382932-33382954 AGAAAATAAAATAAGGAGGTAGG + Intergenic
1080799481 11:35596899-35596921 AAAAACAAAAATAAATAGGTGGG + Intergenic
1080808650 11:35680499-35680521 GCAAATAAAAAGAATGAGGTAGG - Intronic
1080921974 11:36718205-36718227 GTGACTCAAAATAAAGAGGTAGG + Intergenic
1080954385 11:37075972-37075994 GGAGAAAAAAAAAAAGAGATTGG + Intergenic
1081076953 11:38687927-38687949 GCAATTAAAAATAAAGAATTTGG + Intergenic
1081281670 11:41216459-41216481 GTAAAAAAAAAAAAAAAGGTAGG + Intronic
1081311815 11:41583563-41583585 AAAAATAAAAATAAAAAGATAGG - Intergenic
1081927359 11:46842065-46842087 TGAAATTAAAAGAAAGTGGTGGG + Intronic
1082013972 11:47470644-47470666 AGAGATAAGAATAAAGGGGTTGG - Exonic
1082081800 11:48018164-48018186 GGAAAAAAAAAAAAACAGGAAGG - Intronic
1082196762 11:49315978-49316000 AGAGATGAAGATAAAGAGGTTGG + Intergenic
1082938726 11:58680923-58680945 GGAAAGAAAAAAAAAGAAGCAGG + Intronic
1083056167 11:59822135-59822157 AAAAATAAAAATAAATAGGCCGG - Intergenic
1083127260 11:60582964-60582986 GAAAACAAAGATAAATAGGTGGG + Intergenic
1083563242 11:63691415-63691437 CAAAATAAAAATAATTAGGTCGG - Intronic
1083607769 11:63989015-63989037 AGAAAAAAAAAAAAAAAGGTGGG + Intronic
1083700447 11:64474002-64474024 GAAAAAAAAAAAAAAGAAGTGGG + Intergenic
1083767355 11:64848127-64848149 ATAAATAAAAATAAAGGGGGAGG + Intergenic
1084026529 11:66453768-66453790 TGAAATAAAAATAAAGAGGCTGG - Intronic
1084196639 11:67526455-67526477 GAAAAAAAAAAAAAAGAGGGAGG + Intergenic
1084299199 11:68235302-68235324 GGAAATAAAAAGAAAAATGAAGG + Intergenic
1084645031 11:70451582-70451604 GAAAATAAAAAAAAATAGCTGGG + Intergenic
1085113443 11:73909081-73909103 AAAAAGAAAAATTAAGAGGTCGG - Intronic
1085172420 11:74460629-74460651 GGAAAGTAGCATAAAGAGGTTGG + Intronic
1085224926 11:74911235-74911257 AAAAATAAAAATAAAGCTGTGGG - Intronic
1085823600 11:79819173-79819195 AAAAAGAAAAAAAAAGAGGTGGG + Intergenic
1085848151 11:80089501-80089523 GCAAATAAAAATTAAGCTGTAGG - Intergenic
1085903286 11:80728190-80728212 GGAAAGAAAAAAAAAGAGACAGG + Intergenic
1086021960 11:82240482-82240504 TGTAATAAAAATGAAGAAGTAGG - Intergenic
1086196617 11:84148120-84148142 GTAAATAAAAATAAAAATGGTGG - Intronic
1086239899 11:84676974-84676996 GGAGATAACAATGGAGAGGTGGG + Intronic
1086242841 11:84716706-84716728 GCAAAAAAAAAAAAAAAGGTAGG + Intronic
1086446623 11:86877855-86877877 TGCAAAAAAAAAAAAGAGGTGGG + Intronic
1086530177 11:87775602-87775624 TCAAATAAAAATCTAGAGGTAGG - Intergenic
1086592085 11:88526717-88526739 GGGAAAAAAAATTAAGAGGAAGG - Intronic
1086611063 11:88756741-88756763 GGAACAAAAAGTAAAAAGGTAGG + Intronic
1086659066 11:89392221-89392243 AGAGATGAAGATAAAGAGGTTGG - Intronic
1086796301 11:91107941-91107963 GAAAATAAAAATATAGAGTAAGG + Intergenic
1086897644 11:92332232-92332254 GGAAGTAAAAACACAGATGTGGG - Intergenic
1087232343 11:95680367-95680389 GAAAATGAAAACAAAAAGGTGGG + Intergenic
1087264818 11:96048683-96048705 GGAAAAAAAAAGAAAGACTTTGG - Intronic
1087325223 11:96713374-96713396 AAAAATAAAAATAAAAAGGAGGG - Intergenic
1087386460 11:97475191-97475213 GGAAATAAACATTAAGCGGTAGG + Intergenic
1087570090 11:99915827-99915849 GTAAATAAAAATAAAGAGTGTGG + Intronic
1087688533 11:101292821-101292843 GAAAACAAAGATAAATAGGTAGG - Intergenic
1087898956 11:103619041-103619063 GGGAAAAAAAAAAAAGAGGCAGG + Intergenic
1087959651 11:104332775-104332797 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
1088060905 11:105648592-105648614 GGAAAAAAAAAGAAAGAACTAGG + Intronic
1088130782 11:106487386-106487408 TGAGATAAAAATAGAGAGATTGG + Intergenic
1088398754 11:109399535-109399557 GTAAAAGAAATTAAAGAGGTAGG + Intergenic
1088528130 11:110778669-110778691 GGAAATAAAATTAGAGAGTTAGG + Intergenic
1088536317 11:110866012-110866034 TAAAATAAAAATAAAAAGGATGG - Intergenic
1088575169 11:111264646-111264668 AGAAAGAAAAAGAAAGAGGGAGG + Intronic
1088575681 11:111268842-111268864 GAAAAGAAAAGTAAAGAGGCTGG - Intronic
1088718871 11:112574352-112574374 GAAAATACAAAAAAAAAGGTGGG - Intergenic
1088756996 11:112893365-112893387 GGTAATAAAAATCAAGGGGGTGG - Intergenic
1088826781 11:113502320-113502342 CGAAAAAAAAAAAAAGAGGAAGG + Intergenic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1089163365 11:116456578-116456600 AAAAATAAAAATAAAAAGGAAGG + Intergenic
1089404456 11:118186009-118186031 AGAAATCAAAATTAAGAGATGGG + Intergenic
1089563192 11:119356265-119356287 GGAAATTAAAAAAAAAAAGTTGG + Exonic
1089597148 11:119587774-119587796 AGAAAGAAAAAGAAAGAGGCAGG + Intergenic
1090099650 11:123780792-123780814 GGAAAAGAAAATAAAGAGTAGGG - Intergenic
1090479636 11:127056720-127056742 GGAAGAAAAAAGAAAGAGGAAGG + Intergenic
1090776475 11:129970540-129970562 AGAAAAAAAAAAAAAAAGGTTGG - Intronic
1090824719 11:130376380-130376402 AGAAATAAAAAGAAAAAGGGAGG + Intergenic
1090862038 11:130662563-130662585 GGAAATAAAAATCATTAAGTTGG + Intergenic
1090897495 11:130991457-130991479 AGAAAGAAAAAAAAAGAGTTAGG + Intergenic
1090911458 11:131123198-131123220 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
1090950294 11:131467181-131467203 GGAACTAAAGACAAAAAGGTGGG + Intronic
1091096943 11:132832213-132832235 GCAAAAAAAAAAAAAGAGGTTGG - Intronic
1091241810 11:134057972-134057994 GGAAATAGAAAAAAAAATGTTGG - Intergenic
1091479002 12:807384-807406 GTACATAAAAACAAAGAGTTAGG - Intronic
1091720101 12:2806930-2806952 GGAAAAAAAAAAAAAAAGCTGGG - Intergenic
1091746007 12:2993449-2993471 TAAAATAAAAATAAAGTAGTCGG - Intronic
1091981039 12:4864205-4864227 GGAAAAGAAACTAGAGAGGTGGG + Intergenic
1092227415 12:6756870-6756892 TGAAAAAAAAAAAAAGAGGAAGG - Intronic
1092603647 12:10095205-10095227 GGAAATAAAACTAAAACGCTGGG + Intronic
1092684321 12:11024900-11024922 GCAAATAGCAATAAAGAGGCTGG - Intronic
1092774549 12:11931043-11931065 GGAAAGCAAAATAATGAGGCTGG - Intergenic
1092814630 12:12302074-12302096 GGACAGGAAAATAAAGAAGTTGG + Intergenic
1092816091 12:12313424-12313446 GGAAAAAAAAAAAAAGAGGCTGG - Intergenic
1092970468 12:13689419-13689441 GGAAATTAAAAGAAAAATGTTGG - Intronic
1093147988 12:15589378-15589400 AGAAAAAAAAAAAAAGAGGGGGG + Intronic
1093218544 12:16391132-16391154 GAAAAAAAAAAAAAAGAAGTGGG - Intronic
1093284712 12:17244762-17244784 GAAAAGAAAAATAAAGGGATAGG - Intergenic
1093472771 12:19522948-19522970 GTAGCGAAAAATAAAGAGGTGGG - Intronic
1093627874 12:21371704-21371726 AGAAATACAAAAAAAGAGGATGG + Intronic
1093767272 12:22979309-22979331 TGCAACAAAAATAAAGTGGTGGG - Intergenic
1093853266 12:24067225-24067247 TCAAATAAAAATAAAGAGCTGGG + Intergenic
1094216343 12:27946771-27946793 GGAGATGAAAACAAAGAGGGCGG + Intergenic
1094325001 12:29228140-29228162 GGAAAAAAAAAAAAAGAAGTAGG + Intronic
1094336679 12:29364949-29364971 GAAAAAAAAAAAAAAGATGTTGG + Intronic
1094582122 12:31743170-31743192 GGAGATAAAGACAGAGAGGTAGG + Intergenic
1095085936 12:38057395-38057417 AGAAAGAAAAAGAAAAAGGTGGG + Intergenic
1095117752 12:38376071-38376093 TTAAAAAAAAATAAAGAAGTTGG + Intergenic
1095396911 12:41772020-41772042 GGAAAGAGAAAGGAAGAGGTGGG - Intergenic
1095417654 12:41993975-41993997 GTTAATGAAAATAAAGATGTAGG + Intergenic
1095499225 12:42818258-42818280 GTAAAAAAAAAAAAAGAGGAAGG - Intergenic
1095675658 12:44914814-44914836 GGCATTAAAATTAAAGAGGCTGG + Intronic
1095735860 12:45555525-45555547 CGAAACAAAATGAAAGAGGTGGG + Intergenic
1095906675 12:47385406-47385428 GGAAAGAAAAAAAAAAAGGGAGG - Intergenic
1096077216 12:48813447-48813469 ATAAATAAAAATAAAGTGGAAGG + Intergenic
1096151719 12:49317779-49317801 AAAAAAAAAAAAAAAGAGGTCGG + Intergenic
1096276150 12:50209961-50209983 TGAAAACAAAATAAAAAGGTGGG - Intronic
1096352879 12:50915110-50915132 AGAAATGAAAGTAAAGAGTTTGG - Intergenic
1096391963 12:51236653-51236675 GGAAATAATAATGAAGAGACAGG - Intergenic
1096458345 12:51806213-51806235 GGTAAAAAAAATAAAGAGAAAGG + Intronic
1096722349 12:53532638-53532660 GGAAAAAAAAAAAAAGAGAAGGG + Intronic
1097143304 12:56921752-56921774 GGAAATAAAAAAAAACAGGGAGG + Intergenic
1097200930 12:57277967-57277989 GAATAAAAAAATAAAGAGGAAGG + Intronic
1097224408 12:57468752-57468774 TGAAAAAAAAAGAAAGAGTTTGG - Intronic
1097360040 12:58648786-58648808 GGCACTAAAAATAAAGTAGTGGG + Intronic
1098066457 12:66622688-66622710 GGAAATGAAACTAAAAAAGTAGG - Intronic
1098094613 12:66941677-66941699 TGAAATGAAAATGAAAAGGTGGG - Intergenic
1098222350 12:68283497-68283519 ATAAATAAAAATAAATATGTGGG + Intronic
1098391387 12:69973190-69973212 AAAAATAAAAATAAGGAGATTGG - Intergenic
1098552406 12:71777466-71777488 GAGAATAAAAATCAAGAAGTGGG - Intronic
1098555548 12:71814739-71814761 AGAAAAAAAAATAAAGAGGGAGG + Intergenic
1098613653 12:72494578-72494600 GGAAATAAGAGTAAGGATGTTGG - Intronic
1098795356 12:74881206-74881228 GAAAAAAAAAAAAAAGAGGCTGG + Intergenic
1098808837 12:75057903-75057925 CAAAATAAAAATATAGAGGAAGG - Intronic
1098876251 12:75869074-75869096 GTATATAAAAATATAAAGGTGGG - Intergenic
1099143981 12:79015387-79015409 GGAAAAACAAATAAAAAAGTTGG - Intronic
1099227574 12:79988132-79988154 TGAAAGAAAAAAAAAGAAGTGGG - Intergenic
1099297044 12:80841321-80841343 AGAAATGAAAAGAAAGAGGGAGG + Intronic
1099333639 12:81325692-81325714 GGAATTAAAAAGAGAGTGGTTGG - Intronic
1099348857 12:81539216-81539238 AGAAATAGAAATGGAGAGGTTGG + Intronic
1099570509 12:84311362-84311384 AGAAAAAAAAAAAAAGAGGAAGG - Intergenic
1099643861 12:85325452-85325474 AGAAAGAAAAAAAAAGTGGTGGG - Intergenic
1099809148 12:87558489-87558511 GGAAAAAAAAAAAAAAAGGCAGG + Intergenic
1099853250 12:88131835-88131857 GAAAAGTAAAATAAAGATGTTGG - Intronic
1099871713 12:88357985-88358007 GGAGAGGAAAAGAAAGAGGTGGG - Intergenic
1100000185 12:89824943-89824965 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1100221264 12:92506787-92506809 GGACAAAAAAAAAAAAAGGTGGG + Intergenic
1100239320 12:92695033-92695055 GAAAATAATAATAAAGTTGTTGG + Intergenic
1100317472 12:93458146-93458168 AAAAATAAAAACAAAAAGGTTGG - Intergenic
1100328814 12:93566973-93566995 GAAAATAAAAATAATCTGGTTGG + Intergenic
1100556152 12:95695956-95695978 GGAAAGAAAAAGAAAGAGGGAGG - Intronic
1100557309 12:95708551-95708573 AAAAATAACAATAAAGAGGCTGG - Intronic
1100776523 12:97980239-97980261 GAAAATAAAAATAAAAACTTGGG + Intergenic
1100779133 12:98005592-98005614 AAAAATAAAAATAAACAAGTAGG - Intergenic
1100819367 12:98416954-98416976 AAAAAAAAAAAAAAAGAGGTAGG + Intergenic
1102049414 12:109851843-109851865 CAAAAAAAAAAAAAAGAGGTGGG - Exonic
1102128503 12:110505450-110505472 TAAAATAAAAAAATAGAGGTGGG + Intronic
1102145333 12:110650993-110651015 GCAAATAAAATGAAACAGGTTGG - Intronic
1102282343 12:111628326-111628348 GGACATAGAAATTAGGAGGTAGG + Intergenic
1102342979 12:112138248-112138270 AAAAATAAAAATAAAAAGGTAGG + Intronic
1102417204 12:112774254-112774276 ACAAATAAAAGCAAAGAGGTTGG + Intronic
1102443266 12:112979606-112979628 GGAAAAAAAAATTGAGAGGCAGG - Intronic
1102482981 12:113236619-113236641 AGAAAAAAAAAAAAAGAAGTAGG + Intronic
1102855774 12:116292056-116292078 GGAAATAAAAAGCAAGAGGCAGG - Intergenic
1102964530 12:117115604-117115626 TAAAATAAAAATAAAGGGCTGGG - Intergenic
1103223439 12:119266196-119266218 GGAAAGAAAGACAAAGAGGTAGG - Intergenic
1103542429 12:121675388-121675410 AAAAATAAAAATAATGAGGCCGG - Intergenic
1103618141 12:122168442-122168464 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1104222566 12:126799218-126799240 AAAAATAAAAATAAATAGCTGGG - Intergenic
1104317356 12:127716046-127716068 GAAAAAAAAAAAAAAGAAGTTGG + Intergenic
1104408644 12:128540017-128540039 GGAGAAAAAAATTAAGAGGATGG - Intronic
1104491991 12:129202187-129202209 GCAAATAAAAATAAAAAGACTGG + Intronic
1105493174 13:20906841-20906863 GAAAATAAAAATAAAAGGGAAGG + Intergenic
1106125765 13:26898891-26898913 AAAAATAAAAATAAAGCTGTAGG + Intergenic
1106168048 13:27266236-27266258 GGAAATAAAAGAAAAGAAGGAGG - Intergenic
1106660684 13:31796671-31796693 GGGAATAAAAACAAAGAAATTGG - Intronic
1106981338 13:35285852-35285874 GGAAATGAAGACAGAGAGGTAGG - Intronic
1107138785 13:36975282-36975304 AGAAAAAAATTTAAAGAGGTCGG - Intronic
1107305976 13:39019760-39019782 GAAAATAAAAATAAAATGGAAGG + Intronic
1107565259 13:41596041-41596063 GCAAATAAAAATAAAAATGAAGG - Intronic
1107636371 13:42396177-42396199 ATAATTAAAAATAAAGAGGCTGG + Intergenic
1107701651 13:43054758-43054780 GGAAATAGAAATAAAGTATTTGG + Intronic
1107719666 13:43234929-43234951 GGAAATAAAAAAATAGAGACTGG + Intronic
1108196383 13:48000136-48000158 TGAAAAAAAAAAAAAAAGGTAGG + Intronic
1108218687 13:48211201-48211223 GAAAAAAAAAAAAAAGAGGCCGG - Intergenic
1108538716 13:51414944-51414966 GGAAATAATTAGAAAGAAGTAGG - Intronic
1108690680 13:52856801-52856823 GGAAAAAAAAATCCAGATGTGGG + Intergenic
1108842932 13:54642811-54642833 ACAAATAAAAATGAAAAGGTTGG + Intergenic
1109044742 13:57395089-57395111 GGAAATAAAAAAAAAATGTTAGG - Intergenic
1109085791 13:57969906-57969928 AGAAAGAAACAGAAAGAGGTGGG + Intergenic
1109316423 13:60754734-60754756 GGAAGTAAATATAAACAGGAGGG - Intergenic
1109415874 13:62039209-62039231 GGAGATCATAATGAAGAGGTGGG + Intergenic
1109775030 13:67029459-67029481 GGAAAGAAAAATAAAAACATAGG - Intronic
1109783821 13:67148566-67148588 GGTAATTAAAAAAAAGAAGTTGG - Intronic
1109978342 13:69871722-69871744 GGAAAAAAAAAAAAAAAAGTTGG - Intronic
1110003383 13:70234274-70234296 AGAAAGAAAAAGAAAGAGGGAGG + Intergenic
1110020195 13:70459721-70459743 GGAAAGAAAAAAAAAAAGATAGG + Intergenic
1110117129 13:71832968-71832990 AAAAATAAAAATAAAAAAGTAGG - Intronic
1110235357 13:73212152-73212174 GGAAAAAAAAATAAAGACCAAGG - Intergenic
1110316655 13:74115802-74115824 GGCAATAAGAATACAGAGGCAGG - Intronic
1110374102 13:74772968-74772990 ACAATTAAAAATTAAGAGGTTGG + Intergenic
1110448553 13:75616414-75616436 GGAAAAAAAAAAAAACAGGCTGG - Intergenic
1110505481 13:76280936-76280958 GGAAATGAAGAGAAAGAGGCAGG - Intergenic
1110778302 13:79435179-79435201 GGAAATAAAAATTAACATTTGGG - Intergenic
1111187622 13:84760347-84760369 GAATATAAAAATAAAAATGTCGG - Intergenic
1111234673 13:85393249-85393271 GGAAATGAAAATGGAGAGGGAGG + Intergenic
1111249406 13:85583893-85583915 GCAAATAATAATAAAGACTTAGG - Intergenic
1111501300 13:89123426-89123448 GGTCAAAAAAAAAAAGAGGTAGG - Intergenic
1111623550 13:90754616-90754638 GAAAACAAAGATAAATAGGTGGG + Intergenic
1111829617 13:93311019-93311041 TGATATAAAAATGAAGAGTTGGG + Intronic
1111943311 13:94636872-94636894 GGAAATGCAAATTAAAAGGTTGG + Intergenic
1112023281 13:95390587-95390609 AGAAAAAAAAAAAAAGAGCTGGG - Intergenic
1112475575 13:99728563-99728585 AGAAAAAAAAAAAAAGAAGTTGG - Intronic
1112480211 13:99768487-99768509 AAAAAAAAAAAAAAAGAGGTCGG - Intronic
1112557635 13:100483253-100483275 GGAAAAAAAAAAAAGGAGCTGGG + Intronic
1112654533 13:101436179-101436201 GGGAATAAAAATAAACATTTAGG + Intergenic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113237529 13:108296564-108296586 GGCAATTAAAATACAGAGATTGG - Intronic
1113291444 13:108911285-108911307 GGAGATATTAATAAACAGGTTGG + Intronic
1113296081 13:108959975-108959997 GGAAAAAAAAAAAAAAAGCTGGG + Intronic
1113375184 13:109758909-109758931 GGAAAGAAAAAAAAAGAAGGAGG + Intronic
1113511597 13:110859785-110859807 GGAAATAAAAATGATTGGGTAGG - Intergenic
1113536192 13:111067816-111067838 GAAAATGTAAAAAAAGAGGTTGG - Intergenic
1113967622 13:114163333-114163355 ATAAATAAAAATAAAGAAGGCGG + Intergenic
1114203430 14:20544828-20544850 CAAAATAAAAATAAATAAGTGGG - Intergenic
1114315716 14:21508094-21508116 AGAAATAAAAATTAAAAAGTAGG + Intronic
1115453776 14:33578182-33578204 GGAAAAAAAAACAAAGGTGTTGG - Intronic
1115580641 14:34755806-34755828 GGAAAAAAAAAAAAAAAGATAGG - Intronic
1115594242 14:34893884-34893906 TTAAATAAAAATATAGAGATGGG - Intergenic
1115879708 14:37901534-37901556 GGAAATAACAATAAAGAATAAGG + Intronic
1115954893 14:38766656-38766678 GGAAAAAAAAAAAAAAAGGCAGG + Intergenic
1116587400 14:46725671-46725693 GGAAATTAAAAGAAATAGCTTGG + Intergenic
1116797448 14:49407117-49407139 AGAAATAAAAAAAAAGATGTAGG - Intergenic
1116814221 14:49568637-49568659 AAAAAAAAAAAAAAAGAGGTAGG + Intergenic
1116994973 14:51313712-51313734 AGAAAGAAAAAAAAAAAGGTGGG - Intergenic
1117101883 14:52357070-52357092 GGAAATATAATAAAAGAGATAGG + Intergenic
1117105448 14:52393762-52393784 GAGAATAAAAAAAGAGAGGTGGG - Intergenic
1117157688 14:52957084-52957106 TTAATTAAAAATAAAGAGGTGGG + Intergenic
1117184109 14:53222201-53222223 GGAAAAAAAAAAAAACAGGAGGG - Intergenic
1117283194 14:54260519-54260541 AGAAATAAAAATCATGAGTTAGG - Intergenic
1117693754 14:58337946-58337968 GGAAGGGAGAATAAAGAGGTGGG - Intronic
1117826498 14:59709950-59709972 GGAAATAAAATTAAAAAGGAAGG - Intronic
1118164534 14:63323392-63323414 GGAATTACAAATGAAGAGTTTGG - Intergenic
1118177728 14:63458561-63458583 GGTAATAAATATAATGATGTAGG - Intronic
1118177971 14:63461803-63461825 ATAAATAAAAATAAAAAGGAGGG + Intronic
1118469303 14:66060174-66060196 TTAAATAAAAATAGTGAGGTGGG + Intergenic
1118564125 14:67120126-67120148 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1118847897 14:69561835-69561857 GGAAATAAAAAGGGAGAGGCTGG - Intergenic
1118931699 14:70247800-70247822 GGAAGTAAAAATAAAAAGATGGG + Intergenic
1118953465 14:70457324-70457346 GGAAGTAAAAATAAAAAGATGGG - Intronic
1118972187 14:70646208-70646230 GGAAATTCAAAGAAATAGGTAGG + Intronic
1119136760 14:72228402-72228424 AAAAATAAAAATACAGAAGTAGG + Intronic
1119350166 14:73958105-73958127 GGAAAAAAAATTAGAAAGGTGGG - Intronic
1119352434 14:73977117-73977139 GGAAAAAAAAAAAACAAGGTTGG - Intronic
1119373701 14:74170279-74170301 GAATAAATAAATAAAGAGGTAGG + Intronic
1119759883 14:77142733-77142755 GGAAATAGAAATAAGAAGGTGGG - Intronic
1119760512 14:77147655-77147677 GGAAAAAAAAAAAAAGAGAGGGG - Intronic
1119783439 14:77294858-77294880 GGAAATAAAAATAAAGCATTTGG + Intronic
1119989025 14:79173871-79173893 GGAAATAAAAGAAAACAGGAAGG + Intronic
1120177727 14:81313044-81313066 AGAAAGAGAAAGAAAGAGGTAGG - Intronic
1120189416 14:81426915-81426937 GCACATAAAAATAAAGCGGTAGG - Intronic
1120375356 14:83697762-83697784 GGAAACAAAAATAGATAGATAGG - Intergenic
1120548971 14:85846000-85846022 TGAAAGAAAAAGAAAGAGGCAGG + Intergenic
1120573441 14:86150831-86150853 GAAAATCAAAATAAAAAGATTGG + Intergenic
1120600583 14:86500844-86500866 GTAAATAAAAATAAAGATGATGG + Intergenic
1120624762 14:86811231-86811253 GGAAAAAAAAAAAAAGATGGAGG - Intergenic
1120929649 14:89835927-89835949 TGCAATAAAAATATACAGGTTGG - Intronic
1121066119 14:90967030-90967052 ATAATTAAAAATAAATAGGTAGG + Intronic
1121068321 14:90991398-90991420 GAAAATAGAAGTAAAGAGGCTGG + Intronic
1121185649 14:91965544-91965566 GGAAAAAAAAAAAAAAAGGCTGG + Intergenic
1121193963 14:92053656-92053678 AGAAATAAAAATAAATTAGTTGG - Exonic
1121344392 14:93124629-93124651 ATAAATAAAAATAAAAATGTAGG - Intergenic
1121903694 14:97719731-97719753 AGAAAAAAAAAAAAAGTGGTGGG + Intergenic
1123003704 14:105311248-105311270 AAAAATAAAAATAAAAAGGCCGG - Exonic
1123970115 15:25500216-25500238 AGAAATAAAAGAAAAGAGCTTGG - Intergenic
1124031332 15:26015304-26015326 GGAAAAAAAAAAAAAAAGGTTGG - Intergenic
1124048586 15:26174503-26174525 GGAAAGAAAATAAAAGAGGGAGG + Intergenic
1124600853 15:31131869-31131891 GGAAAAAAAATAAAAGTGGTAGG - Intronic
1124799374 15:32815240-32815262 AGAAATAAAAATAAACATGCAGG - Intronic
1124939093 15:34201178-34201200 GAAAATAAAATTAAAGAACTAGG + Intronic
1125195794 15:37044586-37044608 GGAAAGAAAAATGAAGAGAAAGG - Intronic
1125644015 15:41255671-41255693 AAAAATAAAAATAAAGAATTTGG + Intronic
1125698127 15:41656500-41656522 AAAAATAAAAATAAATAGCTGGG - Intronic
1126551515 15:49935982-49936004 AGAAAAAAAAATAAATAGGTTGG - Intronic
1126681094 15:51202854-51202876 GGAAACAAATATAAGGAGGAAGG + Intergenic
1127198467 15:56616442-56616464 AGAAATGAAATTTAAGAGGTGGG + Intergenic
1127442799 15:59027831-59027853 GGAAAAAAAAAAAAAAAGGTGGG - Intronic
1127692281 15:61409115-61409137 AGAAAAAAAAAAAAAGAAGTAGG + Intergenic
1128036011 15:64527301-64527323 GAAAAAAAAAAAAAAGACGTTGG - Intronic
1128082115 15:64862932-64862954 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1128142943 15:65315140-65315162 GAAAAAAAAAAAAAAGAGGCCGG - Intergenic
1128245613 15:66130707-66130729 GGAAAGAAAAAGAAAGAGGGAGG + Intronic
1128286769 15:66443710-66443732 AAAAATAAAAATAAATAGCTGGG + Intronic
1128439660 15:67693602-67693624 GTACATAAAGATAAAGATGTTGG - Intronic
1128500477 15:68223743-68223765 GGAAAAAAAAAAAAAGAGGGGGG + Intronic
1128593151 15:68920639-68920661 TGAAATAAAATGAAAGTGGTGGG + Intronic
1128679355 15:69636729-69636751 GAAAATAAGAGAAAAGAGGTGGG + Intergenic
1128817026 15:70617866-70617888 GAAAATAAAAATTAGGTGGTGGG - Intergenic
1128828223 15:70741052-70741074 TAAAATAAAAATAAAAAGGGGGG + Intronic
1129020197 15:72509894-72509916 GGAAAAAAAAAAAAAAAGGTGGG - Intronic
1129033421 15:72635020-72635042 AGAAAAAAAAAAAAAGATGTAGG - Intergenic
1129216464 15:74102210-74102232 AGAAAAAAAAAAAAAGATGTAGG + Intronic
1129287299 15:74536062-74536084 AGAGATAAAACTGAAGAGGTAGG + Intergenic
1129633403 15:77288231-77288253 GGAAATAAAGTTGAAGAGATAGG - Intronic
1130204534 15:81863910-81863932 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1130271425 15:82451850-82451872 AAAAATAAAAATAAAAAGGAAGG - Intergenic
1130463762 15:84179186-84179208 AAAAATAAAAATAAAAAGGAAGG - Intronic
1130488909 15:84415597-84415619 AAAAATAAAAATAAAAAGGAAGG + Intergenic
1130500504 15:84494355-84494377 AAAAATAAAAATAAAAAGGAAGG + Intergenic
1130828090 15:87570303-87570325 TAAAAGAAAAATAAAGTGGTAGG + Intergenic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1131355429 15:91741784-91741806 GGAAAAAAAAAAAAAAAGGAGGG + Intergenic
1131401817 15:92131357-92131379 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1131490459 15:92858071-92858093 AGAAAGAAAAATAAAAAGGCCGG + Intergenic
1131915870 15:97265554-97265576 AAAAAAAAAAATAAACAGGTGGG - Intergenic
1131954316 15:97715820-97715842 GGAAATAAATATATAGATATAGG + Intergenic
1132124529 15:99211076-99211098 GGAAATAAGAATATACAGGTTGG + Intronic
1133041659 16:3064257-3064279 GAAAAAAAAAAAAAAGAAGTAGG - Intergenic
1133245601 16:4446932-4446954 AGCTATAGAAATAAAGAGGTCGG - Exonic
1133400634 16:5484008-5484030 AAAAATAAAAATAAACAGCTGGG + Intergenic
1133548366 16:6829895-6829917 TAAAATAAAAATAAAGGGCTGGG - Intronic
1133667881 16:7987580-7987602 GGAAAAGAAAATAGAGAGGCAGG - Intergenic
1133804499 16:9114398-9114420 GGAAACTAAAATGGAGAGGTAGG + Intronic
1133879856 16:9771194-9771216 GGAAAAAAAAAAAAAAAGATGGG - Intronic
1134174684 16:11996061-11996083 GAAAAAAAAAAAAAAGAGTTAGG + Intronic
1134210747 16:12274533-12274555 CAAAAAAAAAAAAAAGAGGTGGG - Intronic
1134909157 16:18008521-18008543 GGAAATAAAACTACAGAGCAGGG - Intergenic
1135093518 16:19541694-19541716 GGAAAGAAAAGAAAAGAGGGAGG + Intronic
1135122742 16:19780470-19780492 GGATTTAAAAATAAACAGGATGG - Intronic
1135129089 16:19837403-19837425 AAAAATAAAAATAAAAAGATTGG + Intronic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135150301 16:19999524-19999546 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1135189016 16:20339305-20339327 GTAAATAATAATACAGATGTTGG - Intronic
1135405899 16:22197567-22197589 GAAAAGAAAAAGAAAGAGGCAGG + Intergenic
1135469812 16:22720379-22720401 GTAAAAAAAAAAAAAGAGGGTGG + Intergenic
1135511260 16:23085890-23085912 AGTACTAATAATAAAGAGGTTGG + Intronic
1135581881 16:23634626-23634648 ATAAATAAAAATAAAGAGACAGG - Intronic
1135871001 16:26150364-26150386 GGAAAGCTAGATAAAGAGGTGGG - Intergenic
1136042677 16:27592848-27592870 AGAAATAAAAATAATAAGCTGGG - Intronic
1136053470 16:27670405-27670427 GGAAATCAAAATAAAGATAGAGG - Intronic
1136633832 16:31506790-31506812 GGAAAAAAAAAAATAGAGATGGG + Intronic
1137037064 16:35576445-35576467 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1137381403 16:48002931-48002953 GGAAAAAAAAAAAAAAAGGCTGG - Intergenic
1137507797 16:49069936-49069958 AGAAAGAAAAAGAAAGAGGGAGG - Intergenic
1137631604 16:49949936-49949958 TGAAAAAAAAAAAAACAGGTGGG + Intergenic
1137648622 16:50098357-50098379 AAAAATAATAATAAATAGGTCGG + Intronic
1137769870 16:51007608-51007630 GGGAAGAAAAATATAGGGGTTGG - Intergenic
1137839420 16:51626248-51626270 AAAAATAAAAAAAAAGAGGCCGG - Intergenic
1138243042 16:55444703-55444725 GGAAGAAATAATAAAGAGGCAGG - Intronic
1138743683 16:59338725-59338747 GGAAAGAAAAAAAAAAAGGAGGG - Intergenic
1138747262 16:59377613-59377635 TGTAAAAAAAATAAAGAGTTAGG - Intergenic
1138856200 16:60696482-60696504 AGAAATAAAAATAAGGAGTAGGG - Intergenic
1138995628 16:62449277-62449299 AAAAATAAAAATAAAGAATTTGG - Intergenic
1139006094 16:62573112-62573134 AGAAAAAAAAAAAAAGAAGTAGG + Intergenic
1139096779 16:63714239-63714261 GGGAAAAAAAATAAAAATGTGGG - Intergenic
1139163246 16:64536444-64536466 GGAAATGAAAATAGAAAGTTGGG + Intergenic
1139164258 16:64547363-64547385 GTAAAAAAAAATAAAAAGCTGGG - Intergenic
1139203360 16:65002117-65002139 GGAAAAATAAATAAAGTGGTTGG - Intronic
1139604728 16:68010031-68010053 GGAAAAAAAAATAAGATGGTTGG - Intronic
1139657038 16:68395091-68395113 GAAAAAAAAAAAAAAGAGGCAGG + Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140233120 16:73134324-73134346 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1140286971 16:73612888-73612910 TGAAATGAAAAAAAAGAAGTAGG + Intergenic
1140288457 16:73627271-73627293 GGAGATAAAATTGAAGAGGTTGG + Intergenic
1140515433 16:75537779-75537801 GTAAATAAAAAGCAAGAGGCCGG - Exonic
1140532050 16:75675191-75675213 GAAAAAAAAAAAAAAGAGATGGG + Intronic
1140564782 16:76028797-76028819 AAAATTAAAAATAAAAAGGTAGG + Intergenic
1140767867 16:78176802-78176824 GAAGATAAAAATAAAAAGGAAGG + Intronic
1140977950 16:80078768-80078790 AGTAATAAAATTAAATAGGTTGG + Intergenic
1141109463 16:81260307-81260329 GGAAAAAAAAAAAAAAAGGAAGG + Intronic
1141467150 16:84213866-84213888 AAAAATAAAAATAAAAAAGTTGG - Intergenic
1141562958 16:84882127-84882149 TGATTTAAAAATAAAGAGCTGGG + Intronic
1141683218 16:85555947-85555969 GCAAATAAAAAAAAGGAGGGGGG - Intergenic
1141721936 16:85760930-85760952 AAAAATAAAAATAAAAAGGGAGG + Intergenic
1143261474 17:5602057-5602079 CGAAAAAAAAAAAAAGAGGTGGG - Intronic
1143438627 17:6950363-6950385 GGAAAAAAAAAAAAATAGGATGG + Intronic
1143473494 17:7190587-7190609 GGAAATAAATAAGAAGGGGTGGG + Exonic
1143969550 17:10785637-10785659 GGAAAAAAAAAAAAAGAAATTGG - Intergenic
1144435339 17:15234805-15234827 GGAAAAAAAAAAAAAGAATTTGG - Intronic
1144596604 17:16575222-16575244 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
1144820400 17:18069316-18069338 AGAAATAAAAAAAATTAGGTGGG - Intergenic
1144839175 17:18175073-18175095 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
1144868928 17:18356336-18356358 AAAAATAAAAATAAATAGGTGGG - Intronic
1144943249 17:18955896-18955918 AAAAATAAAAATAAATAGGCCGG + Intronic
1145116257 17:20213256-20213278 GAAAATAAAAATAAAAAATTGGG - Intronic
1145165113 17:20607970-20607992 AAAAATAAAAATAAATAGCTGGG - Intergenic
1145763327 17:27440650-27440672 GGAAAGAAAAAAAAATAGGCTGG - Intergenic
1145921893 17:28615818-28615840 GGAAAGAAAAAAAGAGGGGTGGG + Intronic
1145947130 17:28784909-28784931 GGAAAAAAAAAAAAATAGCTGGG - Intronic
1146002835 17:29141436-29141458 GGAAAAAAAAAAAATGGGGTGGG + Intronic
1146015069 17:29226639-29226661 AGAAAAGAAAAGAAAGAGGTTGG + Intergenic
1146428760 17:32769787-32769809 GGAAGCAAAAAAAAAAAGGTGGG + Intronic
1146521516 17:33529045-33529067 GGAAAGAATAATAGAGAGTTTGG + Intronic
1146536860 17:33659921-33659943 AAAAATAAAAATAAATAGCTGGG + Intronic
1146890546 17:36503831-36503853 GGAAATGAAGAGAAAGAGGCTGG - Intronic
1146916983 17:36684242-36684264 GGAAAAAAAAAAAAAGAAGAAGG + Intergenic
1146964849 17:37017291-37017313 AGAAAGAAAAATAAAAAGGAAGG - Intronic
1146983443 17:37188566-37188588 GGGTAAAAAAAAAAAGAGGTTGG + Intronic
1147284606 17:39391846-39391868 GGAAAAAAAAAAAAAGGGCTGGG + Intronic
1147297920 17:39499503-39499525 AGAAAAAAAAAAAAAGAGGCTGG - Intronic
1147300405 17:39521856-39521878 GGAAAAAAAAAAAAAAAGGCTGG - Intronic
1147402076 17:40186595-40186617 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1147618640 17:41846816-41846838 AAAAATAAAAATAAATAGGCTGG + Intronic
1147710719 17:42462219-42462241 CCAAAAAAAAAAAAAGAGGTGGG + Intronic
1147715284 17:42502742-42502764 GGAAAGAAAACAAAAGAGGGAGG - Intronic
1147779486 17:42930137-42930159 GGAAAAAAAAAAAAAGAAGAAGG + Intergenic
1148239646 17:45991776-45991798 AGAAAAAAAAAAAAAAAGGTAGG - Intronic
1148538587 17:48461637-48461659 GGAAATAATGAAAAAGAGATAGG + Intergenic
1148551641 17:48554134-48554156 GGTAATAATAATAAAGGGATTGG - Intronic
1148895206 17:50835527-50835549 GGAAAAAAAAAAAAAGAAGCTGG - Exonic
1148930475 17:51123209-51123231 GGCAATAAAAAGAAAGTCGTTGG + Intergenic
1148940500 17:51205892-51205914 GGAAATAAAACTAGAGAGAGTGG + Intronic
1149118074 17:53123627-53123649 TGAAAAAAAAAAAAAGAGGCTGG - Intergenic
1149217414 17:54373713-54373735 TCAAAAAAAAAAAAAGAGGTGGG + Intergenic
1149221800 17:54423297-54423319 TGCAACAAAAATAAATAGGTGGG + Intergenic
1149287343 17:55179314-55179336 GGAAAAAAAAATAAAGGAGGGGG + Intergenic
1149344679 17:55722876-55722898 GGGAATAAAAAGAGAGAGGGAGG - Intronic
1149544510 17:57493441-57493463 GAAAATATCAATAAAGAGGCTGG + Intronic
1149700232 17:58649071-58649093 GAAAAAAAAAAAAAAGAGGCCGG - Intronic
1149703505 17:58674838-58674860 GGAAAAAAAAAAAAAAAGGCAGG + Intronic
1149741511 17:59050681-59050703 AAAAATAAAAATAAAGTGGCAGG + Intronic
1149970055 17:61208876-61208898 GGAAAAAAAAAAAAAAAGGAGGG + Intronic
1150011082 17:61504661-61504683 GGCAATAGGAATACAGAGGTTGG - Intergenic
1150025639 17:61671382-61671404 GGTAATAAGAATAAAAAGTTTGG + Intergenic
1150131073 17:62669510-62669532 AAAAATAAAAATAAAAAGGCGGG - Intronic
1150197669 17:63317743-63317765 AGAAATAAAAGTTAATAGGTAGG - Intronic
1150257900 17:63763527-63763549 AAAAATAAAAATAAAAAGGCCGG + Intronic
1150736652 17:67745848-67745870 GCAAAAAAAGATAAAAAGGTGGG - Intergenic
1150770298 17:68035557-68035579 AGAAAAAAAAAAAAAGAGGATGG - Intronic
1150818996 17:68419795-68419817 GGAAAAAAAAAAAAAAAGTTGGG + Intronic
1151122988 17:71813628-71813650 AAAAATAAAAATAAACAAGTGGG + Intergenic
1151277635 17:73047669-73047691 AAAAATAAAAATAAATAGGCTGG + Intronic
1151337670 17:73449595-73449617 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1151484573 17:74390407-74390429 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1151576209 17:74953716-74953738 ACAAATAAAAATAAAAAAGTGGG - Intronic
1151708744 17:75787502-75787524 GGAAAAAAAAAAAAAAAGCTGGG - Intronic
1151754976 17:76069412-76069434 TGAAATAAAAATAAATAAATAGG + Intronic
1151907433 17:77057668-77057690 AAAAATAAAAATAAAAAGATTGG + Intergenic
1152051935 17:77986114-77986136 GGAAATAAATATGAAGAAATGGG + Intergenic
1152173089 17:78766806-78766828 AGACATAAAAATGAAGAGGGGGG + Intronic
1152209031 17:78993248-78993270 GGAAAGAAAAGAAACGAGGTCGG + Exonic
1152482541 17:80564601-80564623 GGAAAAAAAAAAAAAGCTGTTGG - Intronic
1152677585 17:81649551-81649573 GAAAATAACAATAATGAGGCTGG - Intergenic
1153160092 18:2194639-2194661 GGAAAAATAAATAAAGAAGGTGG - Intergenic
1153270859 18:3319659-3319681 AGAAATGAGAATTAAGAGGTGGG - Intergenic
1153523631 18:5975342-5975364 GGAAATAAAAAAAATGCAGTCGG + Intronic
1153555830 18:6312346-6312368 GGAAATATCAATAAAGAAGTTGG - Intronic
1153569733 18:6457196-6457218 GGCAATAAAAATAAATAAATTGG - Intergenic
1153951529 18:10061629-10061651 GGATATAAAAATAAAGAAAAGGG - Intergenic
1154095567 18:11411859-11411881 GTACATAAAAGTAAAGAGGTTGG - Intergenic
1154104536 18:11509930-11509952 AGAAATAAAAGAAAAGAGCTTGG + Intergenic
1154193921 18:12252401-12252423 CAAAATAAAAATAAAGACCTGGG - Intergenic
1154198952 18:12286232-12286254 AAAAATAAAAATAAAGAGCTTGG + Intergenic
1154215414 18:12412184-12412206 GGAAAAAAAAAAAAAAAGGCCGG - Intronic
1154362555 18:13675929-13675951 GAAACTGGAAATAAAGAGGTCGG - Intronic
1155239192 18:23848784-23848806 GAAATTAAAAATCAAGATGTCGG + Intronic
1155628979 18:27869228-27869250 CAAAATAAAAATAAATAGGTGGG + Intergenic
1155728620 18:29122755-29122777 GAAAATAAAAATAAAAAGAGTGG - Intergenic
1155742877 18:29312169-29312191 GGATAGAAAAATAAACTGGTTGG + Intergenic
1155813489 18:30271602-30271624 GAAAATAAAAATAAACAGTAAGG - Intergenic
1156100928 18:33593898-33593920 GGAAATTAAAACAAAAAGATGGG - Intronic
1156124242 18:33883596-33883618 GGAAATCAAAATAACAATGTGGG + Intronic
1156562866 18:38148456-38148478 GTAAAAAAAAATCAATAGGTAGG + Intergenic
1156676273 18:39530324-39530346 GGAAATAACAATGAAGTGGAAGG - Intergenic
1156790518 18:40967502-40967524 TGAAACAAAAATAAATAGATGGG - Intergenic
1156824398 18:41413088-41413110 GGAATTAAAAAAAAAAATGTTGG - Intergenic
1156949740 18:42880797-42880819 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
1157022211 18:43798140-43798162 AGAAAAAAAAATACAGAGGCAGG + Intergenic
1157425520 18:47581015-47581037 AGAAATAAAAAGAAGGGGGTGGG + Intergenic
1157462317 18:47910170-47910192 GGAAAAAAAAAAAAAAAAGTGGG + Intronic
1157897409 18:51482318-51482340 AAAAATAAAAATAAATAGTTGGG - Intergenic
1158060544 18:53335361-53335383 GGTACTAAAAATATAGTGGTGGG - Intronic
1158186505 18:54777866-54777888 AGAAATAAAAAAGAAGGGGTGGG - Intronic
1158295430 18:55992032-55992054 GCAAAGAATAATAAAGAGGTAGG + Intergenic
1158519259 18:58157025-58157047 GGAAAAAAAAAAAAATAGCTGGG + Intronic
1158912492 18:62079024-62079046 GGAAATAAAGTTGAACAGGTTGG - Intronic
1158987617 18:62834841-62834863 GGAAAGGAAAATAAAAGGGTGGG - Intronic
1159066326 18:63571878-63571900 GGAAATAATAAGAGAGAAGTTGG + Intergenic
1159103121 18:63977321-63977343 GGAAAAAAAAAAAAAGATCTTGG - Intronic
1159225913 18:65535771-65535793 GCAAACAAGAATAAATAGGTGGG + Intergenic
1159254006 18:65921886-65921908 GTAAATAAAAATAAAAATGTAGG - Intergenic
1159493557 18:69170433-69170455 GGAAATCAAAATAATTGGGTGGG - Intergenic
1159664948 18:71146272-71146294 GGGCACAAAAAAAAAGAGGTAGG + Intergenic
1160176402 18:76598725-76598747 AAAAAAAAAAAAAAAGAGGTTGG + Intergenic
1160354226 18:78213407-78213429 AGAAAAAAAAAAAAAGATGTGGG - Intergenic
1160604755 18:80041713-80041735 GAAAAAAAAAAAAAAGAGGCAGG - Intronic
1160715418 19:574255-574277 AAAAAAAAAAAAAAAGAGGTCGG + Intronic
1160756950 19:762636-762658 AAAAATAAAAATAAAAAGGAGGG - Intronic
1160916772 19:1500401-1500423 GAAAATAAAAATAAAAAGGCTGG + Intergenic
1160917046 19:1501888-1501910 GTAAATAAATAAAAAGAGCTGGG - Intergenic
1161405101 19:4087093-4087115 GGAAAAAAAAATACCGAGCTGGG + Intergenic
1161488105 19:4546561-4546583 TAAAATAAAAATAAAGAGGCAGG - Intronic
1161525647 19:4753331-4753353 AGAAAAAAAAAAAAAAAGGTTGG + Intergenic
1161535019 19:4813681-4813703 TAAAATAAAAATAAATAGGGAGG - Intergenic
1161601564 19:5187229-5187251 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1161689194 19:5720992-5721014 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
1161845619 19:6710406-6710428 GGAAAGAGAAATAAAGAGAGAGG + Intronic
1161868057 19:6849080-6849102 GAAAAAAAAAATATATAGGTGGG - Intronic
1161946619 19:7441177-7441199 GAAAAAAAAAAAAAAGTGGTGGG - Intronic
1161960140 19:7518761-7518783 AAAAATAAAAATAAAGAAGTGGG + Intronic
1162260037 19:9525276-9525298 AAAAATAAAAATAAAAAGGAAGG + Intergenic
1162363520 19:10233642-10233664 TAAAATAAAAATAAAGAGGCTGG + Intergenic
1162411226 19:10506809-10506831 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1162486645 19:10964612-10964634 AGAAAAAAAAAAAAAGAGGCCGG - Intronic
1163120595 19:15215103-15215125 AAAAATAATAATAAAGAGGCTGG + Intergenic
1163354670 19:16802297-16802319 AAAAATAAAAATAATGAGCTGGG + Intronic
1163584149 19:18154915-18154937 GGAAAAAAAAAAAAAAAGGCTGG + Intronic
1163650088 19:18512335-18512357 AGAAATAAAAATAAAGAAACAGG + Intronic
1163705324 19:18809056-18809078 GGAAAAAGAAAAATAGAGGTTGG + Intergenic
1163911207 19:20195166-20195188 AAAAATAAAATTAAAAAGGTTGG - Intronic
1164185453 19:22863724-22863746 GTAAATAAAAATAATGTGGTAGG - Intergenic
1164314805 19:24077930-24077952 GAAAATAAAAAAAAAGAGCTTGG + Intronic
1164389195 19:27803409-27803431 TGAAATAAAAATGATAAGGTTGG + Intergenic
1164441113 19:28281669-28281691 GGGAATAAAAAAGAAGAGGGTGG - Intergenic
1164633980 19:29779474-29779496 GAAAAAAAAAAAAAAGAGCTGGG + Intergenic
1164714858 19:30384087-30384109 AGAAAGAAAGAGAAAGAGGTGGG - Intronic
1165127008 19:33605289-33605311 AAAAATAAAAAAAAAGAGGCTGG + Intergenic
1165220321 19:34310944-34310966 GGAAAAAAGAAAAAAGAGATTGG - Intronic
1165259750 19:34602584-34602606 GGAAATGAAAAGGAAGAGGAGGG + Intronic
1165280212 19:34790890-34790912 AAAATTAAAAATAAAGAAGTTGG + Intergenic
1165401920 19:35606515-35606537 TGAAATAAAAATAACAAGGAGGG - Intergenic
1165452022 19:35889379-35889401 ACAAATAAAAATAAAGATGTGGG + Intronic
1165604320 19:37087329-37087351 ATAAATAAAAATTAAGAGCTTGG + Intronic
1165680374 19:37769266-37769288 ACACATAAAAATAAACAGGTAGG - Intronic
1165686289 19:37823614-37823636 GGAAAAAAAAAAAAAGATATGGG + Intergenic
1166150346 19:40869251-40869273 GGAAAAGAAAAGAAAGAGGGAGG - Intronic
1166400296 19:42473817-42473839 GGAAAGAAAAAGAAAGGGGAGGG + Intergenic
1166689875 19:44816015-44816037 AAAAATAAAAATAAAAAAGTAGG + Intronic
1166698648 19:44868911-44868933 GGAAAAAAAAAAAAATATGTTGG + Intronic
1166760738 19:45223091-45223113 AGAAATACAAATAAATAGGCAGG + Intronic
1166929617 19:46294195-46294217 TAAAATAAAAATTAAGAGATGGG + Intergenic
1167131545 19:47589483-47589505 GGAAATAAAAATAATAAAGTGGG + Intergenic
1167253760 19:48415377-48415399 AATAATAAAAAAAAAGAGGTCGG + Intronic
1167355887 19:49003771-49003793 GGAAAAAAAAAAAAAGAATTGGG + Intronic
1167703037 19:51061860-51061882 GGAAGTCAGAAGAAAGAGGTTGG - Intronic
1167778637 19:51580262-51580284 AAAAATAAAAGTAGAGAGGTAGG - Intronic
1167789727 19:51666718-51666740 GGAAAGAAAAAGAAAGAGAAAGG + Intergenic
1167799201 19:51729472-51729494 GGAAAAAAAAATGGAGAGGAAGG + Intergenic
1167882065 19:52467865-52467887 GGGAAAAAAAATAAAAAGGTTGG + Intronic
1168058068 19:53874528-53874550 GGCAAGAAGAACAAAGAGGTTGG - Exonic
1168063173 19:53905594-53905616 GGAAATAGAAATTCAGAGGGTGG - Intronic
1168225993 19:54995586-54995608 GGAAAAAATAAAAAAGAGGTAGG + Intronic
1168359929 19:55730922-55730944 GGAAATAAAAAAAAAGAAAGTGG + Intronic
1202687630 1_KI270712v1_random:60570-60592 GGAAGAAAAAATAATGAGGCAGG + Intergenic
925362005 2:3286225-3286247 GCTAATAAAAAAAAATAGGTTGG + Intronic
926184320 2:10676932-10676954 AGAAAAAAAAAAAAAGAGGCCGG - Intronic
926416651 2:12656279-12656301 GTTAATAAAGCTAAAGAGGTAGG + Intergenic
926417393 2:12663399-12663421 GGAACAAAAAATAAGGAGTTGGG - Intergenic
926494004 2:13561485-13561507 GCCAATTAAAATATAGAGGTGGG + Intergenic
926537775 2:14134525-14134547 GGAAATTAAAAGAAAGAGAAAGG + Intergenic
926659725 2:15451209-15451231 GAAAATAAAAATAATTAGCTGGG - Intronic
926718993 2:15944868-15944890 AGAAATAAATATAAAGAACTTGG - Intronic
926731615 2:16039743-16039765 GGAAACAAGAAGAAAGAGGGTGG - Intergenic
926779139 2:16451480-16451502 AGAAATAAAAATAAAGGGCCGGG + Intergenic
926943051 2:18158214-18158236 GTAGAAAAAAATACAGAGGTGGG - Intronic
927073997 2:19558521-19558543 GAAAATAAACATTAAGAAGTAGG - Intergenic
927087723 2:19688000-19688022 GGAAATAAAAATAGGTAGGCAGG + Intergenic
927132922 2:20075645-20075667 GGAAAGAAAAACCAAGTGGTGGG + Intergenic
927308172 2:21597480-21597502 GAAAAAAAAAATAAAAAAGTGGG - Intergenic
927584468 2:24288046-24288068 GGAAACAAAAATAAACAAGTGGG - Intronic
927789460 2:25999028-25999050 AGAAAGAAAAAGAAAGAGGCCGG - Intergenic
927896039 2:26782745-26782767 GGAAATAAAAACAATTAGCTGGG - Intronic
928056338 2:28059094-28059116 ATAAATAAAAATAAAAAGGAGGG - Intronic
928349742 2:30538955-30538977 AAAAAAAAAAAAAAAGAGGTTGG - Intronic
928516231 2:32047231-32047253 GGAAAAAAAAAAAAAGAGAGAGG + Intergenic
928559266 2:32462049-32462071 AAAAATAAAAAAAAAAAGGTGGG + Intronic
928592402 2:32831119-32831141 GCAAATTAAAATAAAGAGATAGG + Intergenic
928598872 2:32884275-32884297 AAAAATAAAAATAAAAAGGCTGG - Intergenic
928763914 2:34618598-34618620 TGAAAAAAAAAAAAAAAGGTGGG + Intergenic
928788473 2:34920305-34920327 GGAAATAAAAATAAATAAAATGG - Intergenic
928985312 2:37174848-37174870 GGTAATAAAAAAAAATAGGTAGG - Intronic
929029676 2:37638596-37638618 AAAAAAAAATATAAAGAGGTAGG - Intergenic
929387584 2:41428164-41428186 GAAAAAAAAAATTAAGAGCTGGG + Intergenic
929406560 2:41649362-41649384 GGAAAAAAAAAAAAATAGGAAGG - Intergenic
929423849 2:41823656-41823678 TAAAATAAAAATAAAGTGATAGG + Intergenic
929492727 2:42410138-42410160 GGTAACAACAATAAAGAAGTAGG - Intronic
929561060 2:42956865-42956887 AGAAAAAAAAATCAAGAGGCTGG - Intergenic
929690484 2:44068401-44068423 GGAAGTTAAAAAAAAGAGGGAGG - Intergenic
930106722 2:47646100-47646122 AAAAATAAAAATAAATAGGCCGG + Intergenic
930198836 2:48533386-48533408 GAAAAGAAAAAAAAAGATGTAGG + Intronic
930246389 2:48987503-48987525 AAAAATAAAAATAATCAGGTGGG - Intronic
930273741 2:49286664-49286686 GAAGATAACATTAAAGAGGTAGG + Intergenic
930322317 2:49871340-49871362 GGCAATAAAAATAAATAAATAGG - Intergenic
930379975 2:50615388-50615410 GGAAATGAAACTGAAGAGGTAGG - Intronic
930655001 2:53999068-53999090 GGAAATACAAAAAAGGATGTGGG + Intronic
930655604 2:54004285-54004307 GCAAATTAAAATGATGAGGTAGG - Intronic
930916801 2:56701465-56701487 GGAACTAAAACTAAAGTTGTAGG - Intergenic
931021621 2:58051143-58051165 GGTAATAAAAAAAAATAAGTAGG - Intronic
931356507 2:61541685-61541707 AAAAATAAAAATAATGAGATAGG + Intergenic
931527455 2:63172519-63172541 AAAAATAATAATAAAGAGGTAGG + Intronic
931615799 2:64156177-64156199 AGAAAAAAATATATAGAGGTAGG + Intergenic
931630487 2:64294089-64294111 GGAATTATAAGGAAAGAGGTGGG - Intergenic
931778500 2:65560258-65560280 AAAAATAAAAATAAACAGCTGGG - Intergenic
932426703 2:71642202-71642224 GGAAAGAAAAATAAAGATTTAGG + Intronic
932713079 2:74082095-74082117 GGACATAAAAATGAAGATCTTGG + Intronic
933283718 2:80361077-80361099 GGAGAACAAAATAAAGGGGTTGG - Intronic
933363458 2:81317436-81317458 GAAATTAAAAATAAACAGATTGG + Intergenic
933364639 2:81334965-81334987 GGATATAAGAATTATGAGGTAGG + Intergenic
933375954 2:81480176-81480198 GCAAAAATAAATAAAGAAGTAGG - Intergenic
933468673 2:82691674-82691696 GAAAATAATAACAAAAAGGTAGG + Intergenic
933843206 2:86304394-86304416 GGAAATAAAACAACAGAGTTCGG - Intronic
933958723 2:87395015-87395037 GGAAGAAAAAATAATGAGGCAGG - Intergenic
933982531 2:87564065-87564087 AGAAAAAAAAATAGAGAAGTTGG + Intergenic
934242853 2:90287021-90287043 GGAAGAAAAAATAATGAGGCAGG - Intergenic
934270323 2:91529662-91529684 GGAAGAAAAAATAATGAGGCAGG + Intergenic
934537078 2:95143633-95143655 TAAAATAAAAATAAAGAACTTGG + Intronic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934589417 2:95532613-95532635 ATAAATAAAAATAAAGAGAAAGG + Intergenic
934683946 2:96306645-96306667 GCAAGTAAAAATAAGGAGATGGG - Intergenic
934694283 2:96387827-96387849 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
935305356 2:101731755-101731777 GGAAAAAAAAAAAAAGATGGAGG + Intronic
935859800 2:107316736-107316758 GGAAAAAAAAAAAAAGATCTTGG - Intergenic
935977855 2:108596825-108596847 AAAAATAAAAATAAAAAGGAGGG + Intronic
936100324 2:109572125-109572147 AAAAACAAAAAAAAAGAGGTGGG - Intronic
936277578 2:111113766-111113788 GGGAATAAGATTAAAGTGGTTGG - Intronic
936311310 2:111386727-111386749 GAAAAAAAAAATAGAGAAGTTGG - Intergenic
936475808 2:112838680-112838702 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
936548444 2:113413453-113413475 GGAAACCATAATAAAGATGTGGG - Intergenic
936719245 2:115230160-115230182 GGAAATAAAATAAAATAGCTAGG - Intronic
936764799 2:115833918-115833940 AGAAAGAAAAATAAGAAGGTGGG - Intronic
936974931 2:118209290-118209312 GGTAATAAAAAGAAAGTGGGAGG + Intergenic
936987565 2:118326052-118326074 GTAAATAAAAATAAATAGCAAGG - Intergenic
937195381 2:120150640-120150662 AGAAATAAAAATAAATGGGGTGG - Intronic
937352736 2:121176791-121176813 GGAAAAAAAAAGAAAGTGGCTGG + Intergenic
937402687 2:121598844-121598866 ATAAATAAAAATAAAAACGTTGG - Intronic
937655044 2:124365323-124365345 GGAAAAAAAAAAAAAAAGGATGG + Intronic
937948886 2:127368324-127368346 AAAAATAAAAATAAGGCGGTCGG + Intronic
938034380 2:128024317-128024339 GGAAAAAAAAAAAATTAGGTTGG + Intronic
938088464 2:128417235-128417257 GAAAAAAAAAAAAAAAAGGTTGG - Intergenic
938170082 2:129068354-129068376 TGAAATAAAAATAAAGAAGTTGG - Intergenic
938182626 2:129196727-129196749 GGGAATAAAAGGAAAGAGATTGG + Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
938627067 2:133122079-133122101 GGAAATGAGAACAAAGAGGGAGG + Intronic
938657416 2:133448249-133448271 GGAAAAAAAAAAAAAGAGGGAGG + Intronic
938732765 2:134159296-134159318 GGGAAGAAAAAAAAAGAGGAAGG - Intronic
938847748 2:135228604-135228626 AGCAATAAAGATAAAGTGGTTGG + Intronic
939064856 2:137470888-137470910 GTAAAGAAAAATAAAGAAATAGG - Intronic
939498711 2:142953466-142953488 GGAAATAAATATAATGAAGATGG + Intronic
939558295 2:143703394-143703416 GGAAAAAAAAATAAAAAGGAAGG - Intronic
939808624 2:146805477-146805499 GGCAAAAAAAAAAAAGAGGAGGG - Intergenic
939856346 2:147363316-147363338 AGAAAAAAAAAAAAAGAAGTAGG + Intergenic
940432588 2:153610678-153610700 AAAAATAAAAATAAACAGATTGG + Intergenic
940630707 2:156234865-156234887 CAAAATAAAAATAAACAGATGGG + Intergenic
940733899 2:157427430-157427452 GGAAAAAAAAAAGAAGAGGAAGG + Intronic
941052558 2:160750881-160750903 GGAAATAAATATGAATAGGTAGG - Intergenic
941053716 2:160763570-160763592 GCAAAAAAAAAAAAAGAAGTAGG - Intergenic
941062679 2:160865595-160865617 TAAAATAAAAATAAAGAGAATGG + Intergenic
941367946 2:164629547-164629569 AGAAAGAAAAAGATAGAGGTTGG - Intergenic
941472219 2:165902194-165902216 TGAAACAAATACAAAGAGGTGGG + Intronic
941807245 2:169721921-169721943 AAAAAAAAAAAAAAAGAGGTAGG + Intronic
941836796 2:170031094-170031116 AATAATAAAAATAAAGAGGAAGG - Intronic
941893855 2:170610030-170610052 GGAAATAAAATTCTTGAGGTGGG - Intronic
941930652 2:170935565-170935587 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
941956597 2:171211842-171211864 TGAAAAAAAAAAAAAGAGGCCGG - Intronic
942174287 2:173316604-173316626 GTACAAAAAAATAAAGAGTTTGG - Intergenic
942425393 2:175855220-175855242 GGAAAAAAAAAAAAATAGGGTGG + Intergenic
942518514 2:176778571-176778593 AGATCTAAAAATAAAGAGATAGG + Intergenic
942599807 2:177629211-177629233 GGAAGGACAAAGAAAGAGGTGGG - Exonic
942677864 2:178447375-178447397 GGAAATAGAATTTGAGAGGTAGG + Intronic
942701594 2:178717399-178717421 GGAAATAAAAATCACCATGTTGG - Intronic
942768474 2:179486015-179486037 GGAAAAAAAAATAATCACGTGGG + Intronic
943078373 2:183226559-183226581 AAAAATAAAAATAAAAATGTGGG - Intergenic
943094258 2:183409751-183409773 AGAAAAAAAAAAAAGGAGGTTGG - Intergenic
943169359 2:184377070-184377092 GAAAAGAAAAATAAATTGGTAGG + Intergenic
943229458 2:185229394-185229416 GTAAAGAAAAAGAAAGAGGGAGG + Intergenic
943282514 2:185954943-185954965 AGGATTCAAAATAAAGAGGTAGG + Intergenic
943454797 2:188092199-188092221 GTAAATAAAAACAAAGGGGTAGG + Intergenic
943659887 2:190547944-190547966 GGAGATAAAAAAGGAGAGGTGGG + Intergenic
943777118 2:191778285-191778307 GTAAATAAACATAGAGAGATGGG + Intergenic
943816198 2:192258768-192258790 GGACATCAATATAAGGAGGTGGG + Intergenic
944084632 2:195831029-195831051 GGAAAGAAAAGTAAAGTGCTGGG + Intronic
944298247 2:198092083-198092105 GGCAGTAAAACTAAAGAGGCAGG - Intronic
944447847 2:199809389-199809411 GGAATTAAAAATAAAGAGTTTGG - Intronic
944746271 2:202659773-202659795 TGAAATAAAAATAAAAAACTGGG - Intronic
944775416 2:202959406-202959428 GGAAATAAGAACAGAGATGTGGG - Intronic
944807107 2:203293501-203293523 GAAAAAAAAAAAAAAGAGGCCGG - Intronic
945011931 2:205473572-205473594 TGAAATAAAAATAAACAGGAAGG + Intronic
945376973 2:209089414-209089436 GCTAAGAGAAATAAAGAGGTGGG + Intergenic
945405775 2:209447038-209447060 AGAAAGAAAAATCAAGATGTGGG - Intronic
945406991 2:209460615-209460637 AGAGAAAAAAATAAAGAGGAAGG - Intronic
945489261 2:210435696-210435718 GGAGAAAAAAATAAAGATGTAGG - Intronic
945607596 2:211955123-211955145 TGAAATAATACTCAAGAGGTAGG + Intronic
945734778 2:213585926-213585948 GGAAAAAAAAAGAAGGAGGAGGG - Intronic
945761974 2:213924591-213924613 GGAAATGAAAATAAAGATGAGGG - Intronic
945791744 2:214313710-214313732 GGAAATAAAACCAAAGAACTTGG - Intronic
945868201 2:215200228-215200250 AGAAAGAAAAATAAAGCTGTAGG + Intergenic
946242540 2:218365724-218365746 GGCATTCAAAATAAAAAGGTTGG - Intronic
946676736 2:222168339-222168361 GAAAATTAAAAAAAAGAGGCTGG - Intergenic
946833388 2:223747691-223747713 GGAAATAAAAATAAGAAGTTTGG - Intergenic
947053331 2:226071908-226071930 AGAAAGAAAATTAAAGAGGGTGG - Intergenic
947064743 2:226210236-226210258 TGAAATAAATATAAAGATATAGG - Intergenic
947123807 2:226845555-226845577 GGAACTGAAAGTAAAGAGATGGG - Intronic
947486601 2:230555704-230555726 GGAAATAATAATAAAGAATAGGG - Intergenic
947572498 2:231247249-231247271 GCAAATTAAAATCAAAAGGTTGG - Intronic
947920776 2:233870519-233870541 GCAAATAAAAATGAAGAGTTTGG + Intergenic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
948137185 2:235645282-235645304 TAAAACAAAAATGAAGAGGTGGG + Intronic
1169031644 20:2413694-2413716 GGAAATAAAAAGAATGAAGTTGG + Intronic
1169055367 20:2616553-2616575 GGAAAGGAAAATAAAGAAGGAGG + Intronic
1169086983 20:2832788-2832810 GAAATTAAAAATATGGAGGTAGG + Intergenic
1169201915 20:3714905-3714927 ATAAATAAAAATAACTAGGTAGG + Intergenic
1169241215 20:3982582-3982604 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1169296438 20:4403952-4403974 GGAAATCAAGAAAAAGAGGCTGG + Intergenic
1169385698 20:5147568-5147590 AAAAATAAAAAGAAAGAAGTGGG - Intronic
1169397518 20:5246306-5246328 AAAAATAAAAATAAATAGATGGG - Intergenic
1169601491 20:7266019-7266041 AAAAATAAAAAAAGAGAGGTAGG + Intergenic
1169636992 20:7703309-7703331 GGAAATAGAGAAAAAGAGGAGGG - Intergenic
1169746197 20:8945564-8945586 GGAAATAAATATAAAGTTCTTGG + Intronic
1170056669 20:12212761-12212783 GAAAAGAAAAATAAAGGGGCAGG + Intergenic
1170329327 20:15191103-15191125 GAAAACAAAAATGAAGAAGTGGG + Intronic
1170339215 20:15304548-15304570 GGAAAGAAGAAGAAAGAGATGGG - Intronic
1170841078 20:19924709-19924731 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1170973344 20:21137469-21137491 GCAAAAAAAAAAAAAAAGGTAGG - Intronic
1171184523 20:23115429-23115451 GGCAATAAAGAAAAAGAGGTAGG - Intergenic
1171184722 20:23117205-23117227 GGAAATATGAACAAAAAGGTGGG - Intergenic
1171241889 20:23576517-23576539 AGAAACAAAAATAAATAGATGGG - Intergenic
1171257576 20:23701709-23701731 GGAAAGAAAAACAATGACGTAGG + Intergenic
1171944601 20:31365265-31365287 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1172291062 20:33777160-33777182 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
1172429711 20:34879244-34879266 GGAGATAAGAATAGAGAGGCAGG - Intronic
1172571630 20:35975295-35975317 AAAAATAAAAAAAAAGAGGCCGG - Intronic
1172659848 20:36560195-36560217 GAAAAAAAAAAAAAAGAGCTGGG + Intergenic
1172721670 20:37003624-37003646 AGAAAAAAAAAAAAAGAGGCAGG + Intronic
1172931220 20:38587716-38587738 GAAAAAAGAAAGAAAGAGGTGGG - Intronic
1173373469 20:42461029-42461051 AAAAATAAAAATAAATAGGCCGG + Intronic
1173962359 20:47084546-47084568 AGAAATAAAAATAAAGAAATGGG + Intronic
1174009218 20:47436137-47436159 AGAAATAAAAATAAAGGGGAAGG - Intergenic
1174213645 20:48899489-48899511 AGAAAGAAAAAGAAAGAGGTAGG - Intergenic
1174495839 20:50942026-50942048 GAAAAGAAAAATAATCAGGTAGG - Exonic
1174980805 20:55392486-55392508 GGAAATAATAGTAGAGAGGTAGG - Intergenic
1175050192 20:56148167-56148189 GGAAAGAAAAAAAAAGATGATGG + Intergenic
1175106242 20:56617036-56617058 GGGAAAAAAAAAAAAGAGGAAGG - Intergenic
1175111705 20:56653062-56653084 GGAAAAAAAAATAAAAAGGCCGG - Intergenic
1175291710 20:57880418-57880440 GGAAAAAAAAATAAAAAGAAAGG - Intergenic
1175307194 20:57984363-57984385 GGAAAAAAAAAAAAAAAGGAAGG + Intergenic
1175746165 20:61458950-61458972 GGAAAAAAAAAAAAAAAAGTGGG - Intronic
1175766066 20:61593992-61594014 GGAAATACAGATTCAGAGGTGGG + Intronic
1177182822 21:17761737-17761759 GGAAATAAAAATAAATAACTGGG + Intergenic
1177386476 21:20415847-20415869 GCAAATAAAACAAAGGAGGTAGG - Intergenic
1177513069 21:22115302-22115324 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
1177583928 21:23064714-23064736 GTAATTAAAAATATACAGGTGGG - Intergenic
1177808222 21:25896856-25896878 GGGAATGAAAAGAAAGAGCTGGG + Intronic
1177902059 21:26928629-26928651 GGAAAGAGAAAGAAAGAGGAAGG - Intronic
1177994996 21:28086136-28086158 AAAAATAAAAATAAATAGCTGGG - Intergenic
1178349484 21:31862342-31862364 AGAAAAAAAAAAAAAGATGTGGG - Intergenic
1178399250 21:32270094-32270116 ATAAATAAAAATAAAAAGCTGGG + Intronic
1178409247 21:32350125-32350147 GAAAAAAAAAAAAAAGAGGGAGG + Intronic
1178665367 21:34542005-34542027 GGACATAAAAATAAATACATTGG + Intronic
1178947122 21:36957929-36957951 GAAAAAAAAAAAAAAGAGGCCGG + Intronic
1179018107 21:37612000-37612022 GGAAATAAAAATATATAGATTGG + Exonic
1179205205 21:39270708-39270730 GGAAATAATAGGAAAGAAGTAGG - Intronic
1179230914 21:39502978-39503000 GGAAAAAAAAAAAAAGAGCTTGG - Intronic
1179317793 21:40260308-40260330 GGAAATTGAAATAAATAGGTGGG + Intronic
1179346080 21:40558785-40558807 GGTGATAAAAATAACGAGGATGG - Intronic
1179779717 21:43691620-43691642 AAAAATAAAAATAAAGAAATGGG - Intronic
1180521932 22:16216748-16216770 AGAGATAAATATAAAGAGATGGG + Intergenic
1180696713 22:17755816-17755838 GAAAAGAAAAATAAAGGGTTTGG + Intronic
1180825963 22:18861811-18861833 GGAAAAAAAAAAAAAGAGACTGG + Intergenic
1181343840 22:22203000-22203022 AAAAAAAAAAAAAAAGAGGTCGG - Intergenic
1181350223 22:22249988-22250010 GGAAGAAAAAATAATGAGGCAGG + Intergenic
1181815459 22:25433455-25433477 ACAAACAAAAATAAACAGGTGGG + Intergenic
1181869877 22:25889544-25889566 AAAAAAAAAAAGAAAGAGGTAGG - Intronic
1181929616 22:26389927-26389949 ACAAATAAAAATAAAAAGGAAGG + Intergenic
1182041619 22:27242614-27242636 GGAAGTAAAAATTCAGAGGAAGG - Intergenic
1182047500 22:27287071-27287093 GGAAAAAAAAACAAAGAAGAGGG + Intergenic
1182137820 22:27922282-27922304 TAAAAGAAAAAAAAAGAGGTTGG - Intergenic
1182403069 22:30098142-30098164 GGAAATAAAAATATAGAACTGGG + Intronic
1183000007 22:34849005-34849027 AGAAAGAAAAAAAAAGAGGAAGG + Intergenic
1183168648 22:36167310-36167332 GAAGATAAAAATAAACAGGCAGG + Intergenic
1183178422 22:36241421-36241443 GAAAACAAAAATAAAGAGATGGG - Intergenic
1183198895 22:36372516-36372538 GGTAATAAAAAAAAAAAGTTAGG + Intronic
1183592950 22:38791686-38791708 AAAAATAAAAATAAATAGGCTGG - Intronic
1183887879 22:40900306-40900328 GGAAAAAAAAAAAAAAAGGCCGG + Intronic
1183895015 22:40961383-40961405 TAAAATAAAAATAAAGAATTGGG - Intronic
1183910558 22:41075803-41075825 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1183970998 22:41477453-41477475 CAGAATAAAACTAAAGAGGTCGG - Intronic
1184013380 22:41766709-41766731 GGAAATAAAAATAATTAGCCAGG - Intronic
1184030238 22:41889702-41889724 AAAAAAAAAAAAAAAGAGGTTGG + Intronic
1184228677 22:43145800-43145822 GGAAAAAAAAAAAAAAAGCTAGG + Intergenic
1184361661 22:44022723-44022745 AAAAATAAAAAAAAAGAAGTAGG - Intronic
1203276105 22_KI270734v1_random:87718-87740 GGAAAAAAAAAAAAAGAGACTGG + Intergenic
949168600 3:971046-971068 GGGAAAATAAATAAAGAGGAGGG - Intergenic
949208950 3:1475115-1475137 AGAAACAAAAATAAATAGATGGG + Intergenic
949258053 3:2073540-2073562 GGAAATACGTATAAAGAGGTAGG + Intergenic
949334268 3:2956775-2956797 GGAAATAAATAGGAAGATGTTGG - Intronic
949435152 3:4021023-4021045 GGAGATTGAAACAAAGAGGTAGG + Intronic
949744608 3:7275152-7275174 GGTAATATAAATAGAGAGATGGG - Intronic
949937882 3:9131071-9131093 GGAATTAGAAATAATGAGATGGG - Intronic
949984558 3:9529924-9529946 GGAAAAAAAAAAAAAGAGCCAGG - Intronic
950039371 3:9910067-9910089 GGATAGAAAGATAATGAGGTTGG + Intronic
950057397 3:10037124-10037146 GTAATTAAAAAAAAACAGGTAGG - Intronic
950327066 3:12120771-12120793 GGGAAATAAAATATAGAGGTAGG - Intronic
950355326 3:12403508-12403530 AAAAATAAAAATAAATAGCTGGG - Intronic
950416125 3:12869830-12869852 GGAAATGAAAAAAAATAGGTGGG - Intronic
951331299 3:21372032-21372054 GGAAATTAAAATATACAGATTGG - Intergenic
951386231 3:22045971-22045993 GGGAAGAAAAATAATGAGGGAGG + Intronic
951685879 3:25343880-25343902 GGAACTAAAAGGAAAGAGGATGG + Intronic
951872697 3:27382527-27382549 AGAACTAAAGATATAGAGGTTGG - Intronic
951892479 3:27580117-27580139 GTAAAAAAAAAAAAAAAGGTAGG + Intergenic
952083283 3:29786821-29786843 AAAAATAAAAATAAATAGATGGG + Intronic
952085607 3:29816793-29816815 GTAGATAAAAACAAATAGGTTGG + Intronic
952112708 3:30142929-30142951 GGAAATAGAGGTAGAGAGGTAGG - Intergenic
952341163 3:32448780-32448802 GGAAAAAAAAAAAAAAAGGCAGG + Intronic
952617785 3:35296028-35296050 GGAAATAGAATCAAAGAGGGTGG - Intergenic
952633006 3:35492657-35492679 AGAGATAACAATTAAGAGGTTGG - Intergenic
952924010 3:38308193-38308215 GGAAAGAAAAAGAAAGAAGGAGG + Intronic
953166049 3:40465865-40465887 GAAAATAAAATTAATAAGGTGGG + Intergenic
953204125 3:40806138-40806160 AAAAAAAAAAATAAAGTGGTGGG + Intergenic
953368860 3:42370306-42370328 AGAAGGAAAAATAAGGAGGTGGG - Intergenic
953690793 3:45117248-45117270 GGAAATAATAATAATTAGGTAGG - Intronic
953963685 3:47285557-47285579 GGAAAAAAAAAAAAAGATTTAGG + Intronic
954235336 3:49252719-49252741 GGAAAAAATAATAAACAGGCTGG - Intronic
954253299 3:49385216-49385238 AGAAAAAAAAAAAAAAAGGTAGG - Intronic
954338977 3:49938315-49938337 AAAAAGAAAAAGAAAGAGGTTGG - Intergenic
954472548 3:50710146-50710168 AAAAATAAAAATAAATAGATGGG + Intronic
954560169 3:51549875-51549897 GGAAAGAAAAATGAAGAGATAGG - Intronic
954834185 3:53450727-53450749 TGAACTAAAAATAAAGAAGCTGG + Intergenic
955127343 3:56126594-56126616 AGAAATAAAAATAAATTAGTTGG + Intronic
955249248 3:57262259-57262281 GGCAATAAAAATAAACAAATGGG - Intronic
955275963 3:57547001-57547023 AAAAATAATAATAAAGAGATGGG + Intergenic
955624271 3:60900049-60900071 GGCAATACAAAGAAAGAGTTGGG + Intronic
955686791 3:61557471-61557493 GAAAAAAAGAATACAGAGGTGGG - Intergenic
955690529 3:61586250-61586272 GGAAATAAAAAAAAAAAAGGTGG + Intronic
955773073 3:62405547-62405569 AAAAATAAAAATAAAAAGGTAGG + Intronic
955795313 3:62630333-62630355 GAAAATAAAATAAAAGAGGCTGG - Intronic
955962063 3:64350858-64350880 GGAAAAAAAAAAAAAAAGCTGGG + Intronic
956077023 3:65516711-65516733 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
956152348 3:66257154-66257176 GGAATTAAGAATACAGAGGGAGG + Intronic
956465252 3:69514387-69514409 TGAAAAAAAAATAAAGAAATAGG + Intronic
956499519 3:69866825-69866847 GAAAAAAAAAAAAAAAAGGTGGG - Intronic
957053067 3:75425157-75425179 GAAAAAAAAAAAAAAAAGGTGGG + Intergenic
957378337 3:79390306-79390328 GGAAAAAAAAATCCAGAGCTAGG + Intronic
957852990 3:85834738-85834760 GGAAAAAAAAAAAAACACGTTGG + Intronic
958121530 3:89295884-89295906 TGAAATGACAACAAAGAGGTCGG - Intronic
958126657 3:89365234-89365256 GGAAAAAGGAATAAAGAGGTTGG + Intronic
958509723 3:95032220-95032242 AAAAACAAAAATAAACAGGTAGG - Intergenic
958560225 3:95739697-95739719 GGAAATAGAAATTAAGAAGAAGG - Intergenic
958693495 3:97498477-97498499 GGAGAAAAAAATAAAGGGGTAGG + Intronic
958879107 3:99649380-99649402 GAAAAGAAAAAAATAGAGGTAGG + Intronic
959149660 3:102593081-102593103 GGAAACAAAACTCAAAAGGTAGG - Intergenic
959346613 3:105203154-105203176 GAAAATATCAATAAAGAGATTGG - Intergenic
959463150 3:106651238-106651260 GGAAAAAAAAAAAAAAAGGCTGG - Intergenic
959644535 3:108682898-108682920 GAAAATAAAAATAAAGTGTTAGG + Intronic
959659429 3:108849598-108849620 GGAATTCAAAATACAGAGCTGGG + Intronic
959705745 3:109337194-109337216 GGGAAAAAAAAAAAAGAGGCCGG - Intronic
959761172 3:109967044-109967066 GGAGGTAAAAATCAAGTGGTTGG - Intergenic
959859800 3:111204388-111204410 GGGAAAAAAAAAAAAGAGGGAGG + Intronic
959882490 3:111460788-111460810 GAAAAAAAATATGAAGAGGTGGG + Intronic
959890423 3:111549120-111549142 GGAAATGAAAATAAGGGGGAAGG - Intronic
959929139 3:111959421-111959443 GGAAATAAAAATCATGGGTTGGG + Intronic
959938516 3:112055881-112055903 GGAAATACAAAGAGAGAAGTGGG + Intronic
959970512 3:112404098-112404120 AGTTATAAAAATAAAGAGGTAGG - Intergenic
960114162 3:113876860-113876882 GGAAAGAGAAAAAAAGAGGAGGG + Intronic
960229653 3:115210201-115210223 GGCCATCAAAATAAAGAGGGAGG - Intergenic
960272168 3:115687108-115687130 GCAAAAAAAAAAAAAGAGGGGGG - Intronic
960335437 3:116411787-116411809 GAAGAAAAAAAAAAAGAGGTGGG + Intronic
960338430 3:116445895-116445917 GGAAAGAAGAAAAAGGAGGTGGG + Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960454748 3:117856842-117856864 GGGAAGATAAATAAAGAGGCGGG - Intergenic
960694992 3:120387494-120387516 GGAAAAAAAAAGAATGAGGTAGG + Intergenic
960767038 3:121143966-121143988 GAAAACAAAAATAAACATGTAGG + Intronic
960850500 3:122047936-122047958 GGTAAGAAAAAGAAATAGGTGGG - Intergenic
960904093 3:122581465-122581487 GGAAATAAAAATCAAAAGCATGG - Intronic
960955694 3:123028848-123028870 TGAAATAAAAATAGATAAGTTGG + Intergenic
961080737 3:124025063-124025085 TGAAATTAGAATAAAGAAGTCGG + Intergenic
961095009 3:124146895-124146917 GAAAAGAAAAAAAAAGAGGTGGG + Intronic
961256358 3:125557362-125557384 ATAAATAAAAATAAAGAGCCTGG - Intronic
961560598 3:127726217-127726239 GGAAAGAGAAAGAAAGAGGAAGG + Intronic
961702187 3:128753795-128753817 AAAATAAAAAATAAAGAGGTGGG - Intronic
961987223 3:131149101-131149123 AAAAATAAAAATAAAGAAGGCGG - Intronic
962000721 3:131293059-131293081 GGAAATAAATATATAAAGATTGG - Intronic
962262371 3:133920819-133920841 GGATATAAATATAAAGATCTGGG - Intergenic
962293034 3:134153501-134153523 TGAAATAAAAAGAGACAGGTTGG - Intronic
962516282 3:136155206-136155228 GGAAAAAAAAAAAAAGACGCTGG + Intronic
962673243 3:137730906-137730928 AAAAACAAAAATAAATAGGTGGG - Intergenic
962796742 3:138856056-138856078 AGAAAAAAAAAGAAAGAGTTGGG + Intergenic
962803353 3:138909188-138909210 AGAAAAAAAAAAAAAAAGGTGGG - Intergenic
963121805 3:141782811-141782833 AGAAAAAAAAAAAAAGAAGTAGG + Intronic
963197015 3:142543568-142543590 AGAAAGAAAAAGAAAGAGGGAGG - Intronic
963217544 3:142766387-142766409 GAAAAAAAAAAAAAAGATGTAGG - Intronic
963285559 3:143431480-143431502 GCAAAAAAAAAAAAAAAGGTGGG - Intronic
963522587 3:146373599-146373621 GGAAAAAAAAAAAAATAGATAGG - Intergenic
963892016 3:150646602-150646624 AAAAATAAAAATAAATTGGTTGG - Intergenic
963913763 3:150839123-150839145 GGAAAACAGAAAAAAGAGGTGGG - Intergenic
963941968 3:151104629-151104651 GGAAATGAAAACATACAGGTAGG - Intronic
964006074 3:151830719-151830741 AAAAACAAAAATAAATAGGTGGG + Intergenic
964131684 3:153295834-153295856 GGAATTAAAAAGAAAAAGGGTGG - Intergenic
964328038 3:155568856-155568878 GGAAATAAAAATGAAAAGCTAGG + Intronic
964350403 3:155797712-155797734 GGAAATAAAATTAAATACCTAGG + Intronic
964357184 3:155861612-155861634 GGAGAAAAAAAGAAGGAGGTGGG - Intergenic
964386296 3:156151630-156151652 GGAAAAATAAATGGAGAGGTGGG - Intronic
964489657 3:157222325-157222347 GGAAATATAAATAAATAAGGGGG + Intergenic
964501606 3:157354304-157354326 GGAGATACAAATCAAGAGCTTGG - Intronic
964614550 3:158648687-158648709 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
964690701 3:159446333-159446355 AGAAACAAATAGAAAGAGGTGGG + Intronic
964776959 3:160289575-160289597 TGAAATCAAAACACAGAGGTTGG + Intronic
964827269 3:160842350-160842372 GGAAATAAAACTAGAGAGGTAGG + Intronic
964942999 3:162184689-162184711 ATGAATAAAAATAAAGAGCTAGG - Intergenic
965064689 3:163831183-163831205 AGAAATAAAAATAATTAGCTGGG - Intergenic
965157998 3:165089295-165089317 ATAAGTAAAAATAAAGATGTTGG + Intergenic
965218743 3:165899198-165899220 AAAAAAAAAAATGAAGAGGTTGG + Intergenic
965681129 3:171252829-171252851 GAACATAAAAATAAACAGCTAGG + Intronic
966426667 3:179787399-179787421 GAAAATAAAAATAAAATGTTAGG - Exonic
966738477 3:183210111-183210133 TGAAGAAAAAATAAAGAAGTTGG + Intronic
966800425 3:183758358-183758380 GGAAAAAAAAATAATAATGTTGG + Intronic
966932447 3:184684726-184684748 AAAAAGGAAAATAAAGAGGTAGG + Intronic
967227709 3:187308133-187308155 AAAAACAAAAATAAAAAGGTGGG - Intergenic
967294937 3:187955515-187955537 TGAAATCAAAATAAACAGTTGGG - Intergenic
967434042 3:189423858-189423880 GCAAATAAAATTAATGTGGTTGG - Intergenic
969611616 4:8230559-8230581 GGAAGTAAAAATACAGAGAATGG - Intronic
969907492 4:10410809-10410831 GGAAAAAAAAAAAAGGAGCTGGG + Intergenic
969909934 4:10435003-10435025 GAAATTAAAAATAAAGATGGGGG - Intergenic
970052875 4:11935628-11935650 GGAAATAATTATAAAGAAGATGG + Intergenic
970214749 4:13746860-13746882 GGAAATACCAATAAAGTGGGTGG + Intergenic
970284062 4:14489683-14489705 AAAAATAAAGATAAATAGGTGGG + Intergenic
970508034 4:16752881-16752903 GGAAAAAAAAAAAAAGAAGGAGG + Intronic
970692489 4:18635461-18635483 GGAAAAAAAAATGAGGAGGTGGG - Intergenic
970838590 4:20440201-20440223 GGAAATAAAAAAAAAATTGTTGG + Intronic
971020516 4:22530611-22530633 AAAAATAAAAATAAAAAAGTGGG - Intergenic
971714967 4:30164637-30164659 GGAAATAAAAATACAAGTGTGGG + Intergenic
971915696 4:32867569-32867591 GGAAAAAAAAAAAAAAAGGAAGG - Intergenic
972239473 4:37174776-37174798 GAAAATAATAACAAAGGGGTAGG - Intergenic
972340620 4:38149454-38149476 GGAAAAAAAAAAAAAAAGATGGG + Intergenic
972536313 4:40002745-40002767 GGAAATAAAAACAAAGCAGTTGG - Intergenic
972744900 4:41923285-41923307 GGAGGTAGGAATAAAGAGGTTGG + Intergenic
972949227 4:44298412-44298434 ATACAGAAAAATAAAGAGGTGGG - Intronic
973166192 4:47080297-47080319 AGAAAAAAAAAAAAAGAAGTAGG + Intronic
973273238 4:48282236-48282258 GGAAAGAAAAAAAAAAAAGTAGG + Intergenic
973569854 4:52226920-52226942 AGTAATAAAAATAAAGTGCTTGG + Intergenic
973766446 4:54167609-54167631 CAAAAAAAAAAAAAAGAGGTGGG - Intronic
973998994 4:56491702-56491724 GGAAATAAGGACAAAGAGCTGGG - Intronic
974149369 4:57986531-57986553 GGTAATAAAAATCAACAGTTTGG + Intergenic
974165266 4:58193168-58193190 AGAAACAAAGATAAATAGGTGGG + Intergenic
974745117 4:66062689-66062711 GGATATAAAAAATAAGAGATAGG + Intergenic
975032471 4:69638224-69638246 GGAAATAAAAATATAAAGGGAGG + Intronic
975101098 4:70513903-70513925 GGAATTAAAAAAAAAAAGCTTGG - Intergenic
975570052 4:75806349-75806371 GGGCATAAAAATTAAAAGGTTGG + Intronic
975607246 4:76167677-76167699 GGAAAAAAAAAAAAAGCGGGGGG - Intronic
975668390 4:76755496-76755518 GGAAATAAGACAAAAGAGGAGGG + Intronic
976099004 4:81540453-81540475 TTAAATAAAAAAAAAAAGGTAGG + Intronic
976188403 4:82466046-82466068 AGAAATAAATAGAAAGAGGATGG - Intergenic
976295264 4:83464997-83465019 GCCATTAAAAATAAAGAGGCCGG + Intronic
976333415 4:83857954-83857976 AGAAAGTAAAATTAAGAGGTGGG - Intergenic
976512969 4:85931932-85931954 GCAAATCAAAAAAAAGATGTGGG - Intronic
976619757 4:87115602-87115624 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
976916848 4:90386624-90386646 GCAAATAAAAATAAATAAGTAGG + Intronic
976981896 4:91242277-91242299 GGAAATAGACATGGAGAGGTAGG + Intronic
976987655 4:91322896-91322918 AGAAATAGAGATAAAGATGTTGG + Intronic
977119268 4:93076603-93076625 AAAAAAAAAAAAAAAGAGGTTGG - Intronic
977187180 4:93954322-93954344 AGAAACAAAAATAAACAAGTGGG + Intergenic
977394940 4:96458866-96458888 TGAAATAACAAGCAAGAGGTTGG + Intergenic
977429368 4:96912210-96912232 AGAAAGAAAAAGAAAGAGGATGG + Intergenic
977521479 4:98089705-98089727 GTAAAAAAAAAAAAAGATGTTGG - Intronic
977713879 4:100158966-100158988 AAAAATAAAAATAAAAAGGAAGG - Intergenic
977781715 4:100988097-100988119 GCAAAGAAATATAAAGAGATGGG + Intergenic
978281264 4:107018058-107018080 GGAAATCAAAATCAAAACGTTGG + Intronic
978426740 4:108591375-108591397 GGAAAAAAAAAAAAAAAGGCCGG + Intergenic
978486412 4:109259511-109259533 TCAAATCAAAATAAAGATGTAGG - Intronic
978498769 4:109386721-109386743 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
978501039 4:109410307-109410329 GGAGGTTGAAATAAAGAGGTTGG - Intergenic
978636508 4:110814361-110814383 GGAAAAAAAAATAAAAGTGTTGG + Intergenic
978690978 4:111509128-111509150 TGGAATAAAAATCAAGAGGAAGG + Intergenic
978805888 4:112799816-112799838 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
978823515 4:112993121-112993143 AAAAATAAAAAAAAATAGGTGGG + Intronic
978976930 4:114888720-114888742 GACAACAAAATTAAAGAGGTGGG - Intronic
979093309 4:116515763-116515785 GGAAAGATGAATATAGAGGTCGG + Intergenic
979588838 4:122453660-122453682 GGAAATAAAAAAAAAAAAGTAGG - Intronic
979729582 4:124008359-124008381 GAAAAAAAAAAGAAAGAGGAGGG - Intergenic
979806565 4:124980158-124980180 GAAAATAAAAATAAAAAGAGGGG + Intergenic
980047233 4:128002607-128002629 GAAAAAAAAAAGAAAGATGTTGG + Intronic
980417230 4:132507242-132507264 TAAAATAAAAATAAATAAGTAGG + Intergenic
980533955 4:134090763-134090785 AAAAAAAAAAATAAAAAGGTGGG + Intergenic
980749660 4:137071464-137071486 GTAAAAAAGAATAAAGAGGGTGG - Intergenic
980873817 4:138640608-138640630 GAAAAAAAAAAAAAAAAGGTTGG - Intergenic
981003249 4:139848980-139849002 GGAAAGAAACAAAAAGATGTAGG - Intronic
981199331 4:141961261-141961283 GAAAATAAAAATAAAATGTTAGG - Intergenic
981467860 4:145094799-145094821 GAAAAAAAAAAAAGAGAGGTAGG + Intronic
981819481 4:148869213-148869235 TGCTATAAAAATAAATAGGTAGG - Intergenic
982223195 4:153141997-153142019 TGAAATAGAAAGAAAGAGGCTGG - Intergenic
982241328 4:153302654-153302676 GGGATTAAAAGTAATGAGGTTGG + Intronic
982362594 4:154536491-154536513 AGAAATAAAAACACAGGGGTAGG + Exonic
982697854 4:158623967-158623989 GGAAAAAAAAATCTAGAGTTGGG - Intronic
982862817 4:160475654-160475676 AAAAACAAAAACAAAGAGGTAGG + Intergenic
983109455 4:163730664-163730686 AAAAATAAAAATAAAAAAGTAGG - Intronic
983125679 4:163948744-163948766 GAAAATAAGAATAAACAGGAAGG + Intronic
983263196 4:165478861-165478883 AGTAGTAAAAATAAAGAAGTTGG - Intronic
983298550 4:165897075-165897097 AGAAAAAAAAATCAAGAAGTGGG - Intronic
983818100 4:172157366-172157388 GAAAATAATTAGAAAGAGGTAGG - Intronic
983838824 4:172429149-172429171 ACAAAATAAAATAAAGAGGTGGG - Intronic
984118148 4:175708209-175708231 GGAAATCTAAACAAAGAGGTGGG + Intronic
984499177 4:180536771-180536793 AGAAAAAAAAATATAGAGATGGG + Intergenic
984892705 4:184507853-184507875 AAAAATAAAAATAAATAGGCTGG + Intergenic
984974048 4:185214577-185214599 AAAAATAAAAATAAAAAGTTGGG + Intronic
985024263 4:185724172-185724194 GAAAATAAGAAACAAGAGGTAGG - Intronic
985989990 5:3548965-3548987 GAAAAAAAAAAAAAAAAGGTTGG + Intergenic
986092855 5:4527448-4527470 GTAAATTAAAACAAGGAGGTAGG + Intergenic
986267811 5:6205383-6205405 GGAAATTCAAATAAAGATGCTGG + Intergenic
986482603 5:8203928-8203950 GGAAGTCCTAATAAAGAGGTTGG + Intergenic
986666522 5:10109332-10109354 ATAAATAAAAAGAAAGAGCTGGG - Intergenic
986767218 5:10939085-10939107 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
986901011 5:12433490-12433512 GGAAAATAAAAGAAAGAGGAAGG - Intergenic
986904835 5:12484232-12484254 GGTATTAAAAATAATGAAGTAGG + Intergenic
987273222 5:16335378-16335400 GTTAATAAAAATAAAGATATAGG + Intergenic
987348482 5:16999719-16999741 GGAAAAAAAAAAAAAAAGGCCGG + Intergenic
987743880 5:21945444-21945466 AAAAAAAAAAAAAAAGAGGTTGG + Intronic
988288839 5:29258197-29258219 CGAAAAAAAAAAAAGGAGGTGGG + Intergenic
988409502 5:30868948-30868970 GAAAATAAAAATAAAAAGCTTGG + Intergenic
988432352 5:31134177-31134199 GGAATTAAAAAATAAAAGGTGGG - Intergenic
988814801 5:34824474-34824496 GAAGATAAAGATAAAAAGGTTGG + Exonic
988889943 5:35604700-35604722 AGAAACAAAAATAAAGAGATGGG + Intergenic
989099864 5:37813553-37813575 AAAAAAAAAAAAAAAGAGGTTGG - Intronic
989393729 5:40930197-40930219 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
989625070 5:43421548-43421570 AAAAATAAAAATAAATAGCTTGG + Intergenic
989796488 5:45480628-45480650 GGAAATTAAAATAACTAGGAAGG + Intronic
989801808 5:45551376-45551398 GTAACTAAAAAAAAAAAGGTTGG - Intronic
989963037 5:50438898-50438920 GGAAAAAAAAAAAAAAAGGTAGG - Intronic
989963683 5:50444540-50444562 AGAAAAAAAAAAAAAAAGGTAGG - Intergenic
990011404 5:51003630-51003652 TTAAAAAAAAACAAAGAGGTAGG - Intergenic
990230514 5:53708201-53708223 GGAACCAAAAAAAAAGAGCTTGG - Intergenic
990314756 5:54573596-54573618 AGAGATGAAGATAAAGAGGTAGG + Intergenic
990385212 5:55253726-55253748 GTGAATAAAAATGAAAAGGTGGG - Intergenic
990387142 5:55276777-55276799 GGAAAAAAAAATAAAAAGAGTGG - Intronic
990576524 5:57128766-57128788 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
990632597 5:57686885-57686907 ACAAATAAAAATAAAGAGGCTGG - Intergenic
990905632 5:60800087-60800109 CGAAAAAAAAATGAAGAGGAGGG + Intronic
990914248 5:60886014-60886036 GGAAATATAAATAATGTAGTTGG - Intronic
991080130 5:62589554-62589576 GGGAATAAAGAGAAAGGGGTAGG - Intronic
991223161 5:64238844-64238866 AGAAACAAAAATAAATAAGTGGG - Intronic
991408624 5:66325489-66325511 GGAAATAAAATTAATGAAATCGG + Intergenic
991410113 5:66337404-66337426 GAAAAGACAAAAAAAGAGGTGGG - Intergenic
991532410 5:67630531-67630553 GGAAAGAAAAAAAAAAAGGCAGG - Intergenic
991764081 5:69955582-69955604 AAAAAAAAAAAAAAAGAGGTTGG + Intergenic
991783244 5:70162564-70162586 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
991843313 5:70830654-70830676 AAAAAAAAAAAAAAAGAGGTTGG + Intergenic
991875688 5:71162889-71162911 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
991914733 5:71594529-71594551 AAAAAAAAAAAAAAAGAGGTGGG + Intronic
992148914 5:73881233-73881255 GGAAAAAATAATAAAGTGGAAGG - Intronic
992315664 5:75551274-75551296 AGCAATAAAAATAAAAAGATAGG + Intronic
992731892 5:79679410-79679432 GGAAAAAAAAATATAGAGGTGGG + Intronic
992734418 5:79704510-79704532 GAGAACAAAAATAAAGGGGTAGG - Intronic
992798564 5:80275104-80275126 AAAAAAAAAAAAAAAGAGGTTGG + Intergenic
992815730 5:80435501-80435523 GGAAGTCAAAACAAAGACGTTGG + Intronic
993011788 5:82491594-82491616 GGCAATAAAAACCAAGAGGTTGG + Intergenic
993440155 5:87946670-87946692 GGAATGAAAAAAAAAAAGGTGGG + Intergenic
993628642 5:90257058-90257080 GGAGATTAAAATAAACAGGTAGG + Intergenic
993645188 5:90453111-90453133 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
993671909 5:90770643-90770665 GCAAATTAAAACAAAGATGTAGG - Intronic
993704706 5:91156368-91156390 AGAAAGAAAAACAAAGAGGAAGG + Intronic
993863322 5:93162356-93162378 AGCAACACAAATAAAGAGGTGGG - Intergenic
993905576 5:93620474-93620496 AAAAAAAAAAAAAAAGAGGTGGG + Exonic
993916432 5:93748464-93748486 GAAAATAAAAAGACAGAGGCAGG + Intronic
993979904 5:94532499-94532521 GGAAAGAAAAGGAAAGAGGGAGG - Intronic
994055024 5:95405413-95405435 TGAAATAAAAAATAAAAGGTAGG - Intronic
994098550 5:95869685-95869707 GCCAAAAAAAAAAAAGAGGTAGG - Intergenic
994150303 5:96440169-96440191 AGAAAAAAAAAAAAAAAGGTGGG - Intergenic
994412042 5:99418895-99418917 GGAAACAAAATAAAAGTGGTTGG - Intergenic
994481782 5:100346365-100346387 GGAAACAAAATAAAAGTGGTTGG + Intergenic
994557939 5:101328718-101328740 GGAAATAAAAATAATTATGGAGG + Intergenic
994710006 5:103255584-103255606 GAAAAAAAAAATGAAGAGGAAGG + Intergenic
994819939 5:104636420-104636442 GAAAATAAAAATATAGAGAAAGG + Intergenic
994880690 5:105490741-105490763 TGAAATAAAAAAAAAAATGTTGG + Intergenic
994922948 5:106074610-106074632 AAAAATAAAAATAAATAGCTGGG + Intergenic
994998310 5:107094288-107094310 GGGAATAAAAATAATGAGACGGG + Intergenic
995062524 5:107826655-107826677 TTAAAAAGAAATAAAGAGGTGGG + Intergenic
995490029 5:112681070-112681092 GAAAAAAAAATTAAAAAGGTAGG - Intergenic
995608541 5:113884813-113884835 GGGAAAAAAAAGAAAGAAGTAGG - Intergenic
995674830 5:114651731-114651753 GAAAAAAAAAAAAAAGAGGAAGG + Intergenic
995842824 5:116460064-116460086 AAAAATAAAAATAAAAAGGAGGG + Intronic
996167551 5:120243626-120243648 GGACATCAGAATAAAGAGGGAGG + Intergenic
996247024 5:121276697-121276719 GGATACAAAAATATAGAGTTTGG + Intergenic
996280455 5:121724190-121724212 GGAAAGAAAAATAAAAAAGAAGG - Intergenic
996388250 5:122932471-122932493 TAAAATAAAAATAAACAGGTAGG + Intronic
996439345 5:123472059-123472081 AGAAAAAAAAAAAAAAAGGTGGG + Intergenic
996724203 5:126659630-126659652 TGAAAAAAAAAAAAAGAAGTTGG + Intergenic
996982771 5:129519647-129519669 GGAAAAAAAAAAAAAGAGACAGG + Intronic
997005379 5:129810735-129810757 TGAAATAAAAATAAAGATAGAGG - Intergenic
997135668 5:131322497-131322519 AAAAATAAAAATAAAAAGGAAGG - Intronic
997317102 5:132945762-132945784 AAAAATAAAAATAAACAGGCCGG + Intronic
997787072 5:136723161-136723183 AGAAAAAAAAAGAAAGGGGTAGG - Intergenic
997913659 5:137901997-137902019 GGAAAAAAAAAAAAAGTGGGAGG + Intronic
998048776 5:139013037-139013059 AGAGAAAAAAATAAAGAGATGGG - Intronic
998181071 5:139943139-139943161 AGAAATAAAAATAAAAAGTGAGG - Intronic
998218875 5:140259027-140259049 GTAAATAAAACTAAAAAGGAGGG + Intronic
998306223 5:141079591-141079613 GTAAATAAAAATTCAGAAGTAGG + Intergenic
998433372 5:142085608-142085630 AGAAAAAAAAAAAAAGATGTAGG + Intergenic
998579069 5:143351035-143351057 GGAAATAAAAGGATAGATGTGGG - Intronic
998700255 5:144690211-144690233 GGAAGTATGAATAAAGAGCTTGG - Intergenic
998709986 5:144813196-144813218 GAAATGAAACATAAAGAGGTAGG + Intergenic
998770637 5:145540688-145540710 AGAAAAAAAAAAAAAAAGGTGGG + Intronic
998843870 5:146285565-146285587 GGATATAAAAACAAAGATTTAGG + Intronic
998871090 5:146552616-146552638 GAAAAGAAAAATAATAAGGTAGG - Intergenic
998885258 5:146687218-146687240 GGGACTAAAAATCAAGAGTTAGG - Intronic
998987815 5:147781554-147781576 CCAATTAAAAATAAAGAGGCAGG + Intronic
999007122 5:147994990-147995012 GGAAAAAAAAAAAAAAAGTTTGG - Intergenic
999317010 5:150590817-150590839 GGTAATGACAATAAAGAAGTGGG + Intergenic
999513289 5:152275528-152275550 GGAAATAATATCAAAGAGGTAGG - Intergenic
999523199 5:152374156-152374178 GGAAATAAAAAAAAAGATTAAGG + Intergenic
999630671 5:153567836-153567858 GGAGATAAAAATAGAGAGGTAGG + Intronic
999787665 5:154906578-154906600 AAAAAGAAAAATAAAGAGATGGG + Intronic
999982213 5:156968417-156968439 GGAATTAGAAATTAAGATGTGGG - Intergenic
1000263268 5:159610721-159610743 GGAAACATAAATAAAGATGAGGG + Intergenic
1000291300 5:159873953-159873975 GCATAAAAAAACAAAGAGGTGGG - Intergenic
1000493142 5:161940939-161940961 GGAAATAAAGATAGACAGATTGG - Intergenic
1000556113 5:162728173-162728195 GGGAAGAAAAATAAAGCGTTTGG - Intergenic
1000622828 5:163505126-163505148 AGGAATAAAAATAAAAGGGTTGG - Intronic
1001001624 5:168012936-168012958 GGAAATAAAACCAAAGTGCTGGG - Intronic
1001370086 5:171191234-171191256 AGAAATAAAAACACAGAGGAAGG + Intronic
1001585402 5:172830765-172830787 GGAAAAAAAAATAATGAGGATGG + Intergenic
1001660135 5:173385013-173385035 GGAGGGAAAAATAAAGAAGTGGG - Intergenic
1001776150 5:174330599-174330621 AGAAATAAGAAGAAAGAGGACGG + Intergenic
1001828978 5:174769196-174769218 GGAAATAAAGAGAAAAAGGAAGG + Intergenic
1001901770 5:175436905-175436927 GGAAAGAAAAGAAAAGAAGTAGG - Intergenic
1002178524 5:177416981-177417003 AAAAATAAAAATAAAGAGGAAGG - Intronic
1002289811 5:178192619-178192641 GGAAGAAAAAAGAAAGAGGGAGG + Intergenic
1003219448 6:4145652-4145674 GGAAATCAAGAGAGAGAGGTAGG + Intergenic
1003376652 6:5584520-5584542 GGAGAGAAAAAGAAAGAGGAAGG - Intronic
1003413277 6:5885011-5885033 GGAAAGAAAAATACATATGTAGG - Intergenic
1003471149 6:6434952-6434974 GAAAAAATAAATCAAGAGGTAGG - Intergenic
1003503600 6:6722677-6722699 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1003953580 6:11141718-11141740 AGAAAAAAAAAAAAAGAGGCTGG + Intergenic
1004040398 6:11969611-11969633 GGAATTAGAAATAAAGAGGGTGG - Intergenic
1004088200 6:12472573-12472595 AAAAATAAAAAAAAAGAGGGAGG + Intergenic
1004088644 6:12476484-12476506 TGAAAGAGAAATAAAGGGGTAGG + Intergenic
1004335567 6:14761577-14761599 GGAAATAAAATGAATCAGGTGGG + Intergenic
1004375281 6:15085726-15085748 TAAAATAAAAATAAATAGCTGGG + Intergenic
1004849648 6:19685224-19685246 GGAAATAAGAAAAGAGAGGCAGG + Intergenic
1004912085 6:20296011-20296033 GGAGAGAAAAAAAGAGAGGTTGG - Intergenic
1004973604 6:20939378-20939400 GGAAATAACAAAAAAGAACTGGG + Intronic
1004981878 6:21033290-21033312 GGCAATGGAAATAAAGAGGAAGG + Intronic
1005201183 6:23346500-23346522 CCAAATAAAAATAAAGATGAGGG + Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1005980186 6:30830570-30830592 GGAAAGAAAAAAAAAGAAGTTGG - Intergenic
1006126678 6:31843327-31843349 GAAAAAAAAAAAAAAGAGGGTGG - Intergenic
1006138174 6:31909596-31909618 ACAAAAAAAAAAAAAGAGGTGGG - Intronic
1006249395 6:32768158-32768180 GGAAAAAAAAAAAAAAAGGAGGG + Intergenic
1006328316 6:33371074-33371096 GAAAATAAAAATAAAAAAGCAGG + Intergenic
1006365430 6:33612357-33612379 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
1006469697 6:34221438-34221460 AAAAAAAAAAAAAAAGAGGTCGG - Intergenic
1006820242 6:36887658-36887680 GGAAATGAAACTGAACAGGTAGG + Intronic
1006875108 6:37288744-37288766 AAAAAAAAAAAAAAAGAGGTTGG + Intronic
1006968108 6:38010594-38010616 GAAAAAAAAAAAAAAAAGGTTGG - Intronic
1007035390 6:38668254-38668276 ATAAATAAAAATAAAGAAGAGGG + Intergenic
1007349927 6:41264206-41264228 AAAAATAAAAATAAATAGGCTGG + Intergenic
1007448541 6:41925657-41925679 ATAAATAAAAATAAATAGGCCGG - Intronic
1007587113 6:42997977-42997999 TCAAATATAAATAAAGAGATAGG - Intronic
1008098535 6:47366099-47366121 AGAAATAAAAATAAAGACACAGG + Intergenic
1008477407 6:51947257-51947279 AGAAAGAAAAACAAAGAGGCTGG - Intronic
1008729686 6:54466437-54466459 GGAGCTAAAATCAAAGAGGTAGG + Intergenic
1008872756 6:56291255-56291277 GGGAACAAAAAGAAAGAGATTGG + Intronic
1009358055 6:62776653-62776675 AGAAAAAAAAAAAAAAAGGTTGG + Intergenic
1009397625 6:63218383-63218405 GGAAATATAAATAATAAGGCTGG - Intergenic
1010007851 6:71015117-71015139 GGTAATAAATATTAAGAGTTTGG + Intergenic
1010200593 6:73278524-73278546 GAAATTAAAAATAAAGAGCTAGG - Intronic
1010396149 6:75394489-75394511 CAAAATAAAAATAATGAGATAGG + Intronic
1010423131 6:75696772-75696794 GGAATTATAAAGAAAAAGGTGGG - Intronic
1010605718 6:77887591-77887613 AGAAATAAATATTAAGAGGCCGG - Intronic
1010776061 6:79887389-79887411 AAAAATTAAAAAAAAGAGGTGGG + Intergenic
1010833508 6:80558811-80558833 GGAAATAAAAATATTGACTTGGG + Intergenic
1011085584 6:83537071-83537093 GGAAAAAAAGAAAAAGAGGAAGG - Intergenic
1011088690 6:83571103-83571125 TGAAAAAAAAAAAAAGAGGTGGG - Intronic
1011172902 6:84526024-84526046 GGAAATAAGATTAGTGAGGTAGG + Intergenic
1011235351 6:85210973-85210995 GGAAAGAAAAAAAAAAAGGCAGG - Intergenic
1011259956 6:85460634-85460656 GGAAAAAAAAACATAGAAGTTGG - Intronic
1011305045 6:85916678-85916700 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
1011586221 6:88928049-88928071 AAAAATAAAAATAAATAGCTGGG + Intronic
1011604957 6:89094214-89094236 ATAAAAAAAAATAAAGAGGCCGG - Intergenic
1012048585 6:94310075-94310097 AGAAAAAAAAAAAAAGAGCTGGG - Intergenic
1012048699 6:94311548-94311570 AAAAATAAAAATAAATAGCTGGG - Intergenic
1012140380 6:95619429-95619451 GGAAAGCAAAAGAAATAGGTGGG + Intergenic
1012279383 6:97310844-97310866 GGAGATAAAATTATAAAGGTAGG + Intergenic
1012736807 6:102958033-102958055 AAAAATAAATATAAAGAAGTGGG - Intergenic
1012764689 6:103351888-103351910 AGAAAGAGAAATAAAGAGGCAGG - Intergenic
1012887888 6:104865689-104865711 TGAAAAAAAAAAAAAGAGGCCGG + Intergenic
1012957121 6:105583107-105583129 GGAAAAAAAAAAAAAAAAGTGGG - Intergenic
1013166221 6:107594817-107594839 GGAAATTAAAATGCAGAGATGGG + Intronic
1013319608 6:108974525-108974547 GGAAATAAAAATAAATTTGCTGG + Intergenic
1013496691 6:110704866-110704888 GGCAATAAAAATAGAAAGGAGGG + Intronic
1013753183 6:113430719-113430741 TGAAATAAAAAAAAATAGGCTGG - Intergenic
1013763130 6:113541535-113541557 GGAAAAAAAAATACAGAACTAGG - Intergenic
1013835310 6:114328019-114328041 GGAAATGAAATAATAGAGGTAGG + Intronic
1013886043 6:114968954-114968976 TGAATTAAAATTAGAGAGGTAGG - Intergenic
1014002217 6:116376958-116376980 AGAAATAAAACTCAAAAGGTGGG - Intronic
1014155191 6:118101716-118101738 GGAGGTATAAATAAAGGGGTGGG + Intronic
1014466154 6:121759507-121759529 AGAAACAAAAATAAGGAAGTGGG - Intergenic
1014662305 6:124188225-124188247 GGAAATATATATTAAGAGATTGG + Intronic
1014682736 6:124452557-124452579 TGAAATAAAAATAAACATTTGGG + Intronic
1014946930 6:127510063-127510085 AGAAATAAAAAAAAACAGGAAGG - Intronic
1014963821 6:127721617-127721639 GGAGCTAAAAATAAACAAGTGGG - Intronic
1015053221 6:128867724-128867746 GGAAACAAAAAACAAGAAGTTGG - Intergenic
1015055950 6:128903738-128903760 GGAAATTAAGATAAAGAGCTTGG + Intronic
1015103311 6:129506377-129506399 AAAAATAAAAATAAAGTGATTGG + Intronic
1015195045 6:130516494-130516516 TGAAATAAAAACAAGGATGTTGG - Intergenic
1015307908 6:131730983-131731005 GGAATTAAAGACAAAGAGATGGG - Intronic
1015352883 6:132243851-132243873 GCATATAAAAATAAATAGATAGG - Intergenic
1015404920 6:132826249-132826271 GAAAATAAATATAAATAGGCCGG + Intergenic
1015429055 6:133108704-133108726 GCAAAAGAAAATAAAGAGTTAGG - Intergenic
1015560436 6:134509512-134509534 GGAAATAAAAATCAAAAATTAGG + Intergenic
1015771218 6:136770111-136770133 ATAAATAAAAATAAAAAGGGAGG - Intronic
1015795250 6:137004763-137004785 GTAAAAAAAAAAAAAAAGGTGGG + Intronic
1016937831 6:149461044-149461066 AGAATTAAAAATGAAGAGGCTGG + Intronic
1016951444 6:149584561-149584583 GGAAATGTAAACTAAGAGGTGGG - Intronic
1017258878 6:152364371-152364393 GGAAATACAAATAGAGGAGTGGG - Intronic
1017404214 6:154099489-154099511 GGAAAGAAAAAGAAAGAGGAAGG + Intronic
1017521958 6:155210310-155210332 GGAAAGAAAAAGAAAGAGGAGGG - Intronic
1017868214 6:158463311-158463333 GGAAATAAAAACAAATAGAAAGG - Intronic
1017877277 6:158535601-158535623 GGGAATAAAAATACAGAGCAAGG + Intergenic
1017926725 6:158917143-158917165 GGAAAAAAAAAAAAAAAGGAAGG - Intergenic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018044734 6:159955876-159955898 GAAAAGAAACATAAAAAGGTAGG + Intergenic
1018194292 6:161341344-161341366 GGAAAAAAAAATTAGGAGGCTGG - Intergenic
1018920994 6:168174073-168174095 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
1019454795 7:1121271-1121293 GAAAATAAAAACAATGTGGTGGG + Intronic
1019902494 7:4033017-4033039 TGAAATAAAAGTAATGAGGGTGG + Intronic
1019965152 7:4492604-4492626 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1020160595 7:5768293-5768315 GGAAAAAAAAAAAAAAAGGCTGG + Intronic
1020174483 7:5871362-5871384 AAAAAAAAAATTAAAGAGGTAGG + Intergenic
1020179173 7:5907939-5907961 GGAAAAAAAAAAAAATAGCTGGG + Intronic
1020256867 7:6507378-6507400 TGAAAAAAAAAAAAAGGGGTGGG + Intronic
1020354442 7:7261292-7261314 GGAAATAAAAATTAAGATTGAGG - Intergenic
1020356894 7:7287363-7287385 GAAAGCAAAAATAAAGAAGTGGG + Intergenic
1020444240 7:8251970-8251992 GGCAGTAATAACAAAGAGGTAGG + Intronic
1021034303 7:15778489-15778511 GGAAATTAAAACTCAGAGGTGGG - Intergenic
1021132587 7:16928970-16928992 GGGAAAAAAAATAAAGATGGAGG - Intergenic
1021203381 7:17751953-17751975 GGAAATAAAAAAAGAGCAGTAGG - Intergenic
1021358108 7:19678839-19678861 GAAAAGAAAAAACAAGAGGTAGG + Intergenic
1021422046 7:20456474-20456496 ATATATAAAAAAAAAGAGGTCGG - Intergenic
1021739004 7:23666454-23666476 GGAAAGAAAAAGAAAAAGATTGG + Intergenic
1021816017 7:24448490-24448512 TGAAATAAAAAAGAAGAGGCCGG + Intergenic
1021876225 7:25052096-25052118 TGAAATAAAAATAAATAGGCCGG + Intergenic
1022194990 7:28056150-28056172 GTAGATAATAATAAAGGGGTGGG + Intronic
1022389685 7:29932724-29932746 AGACATACAAATAAGGAGGTGGG + Intronic
1022436088 7:30387091-30387113 GGAAACAAACATGATGAGGTAGG - Intronic
1023047101 7:36219680-36219702 GGAAAGAAGAAGAAAGAAGTGGG + Intronic
1023053800 7:36275759-36275781 GGAAATAAAAATAATAAAGGTGG - Intronic
1023067843 7:36396691-36396713 GGGAAGAAAAATAAAGGAGTAGG + Intronic
1023102003 7:36727304-36727326 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1023227258 7:37983692-37983714 AGAAAAAAAAATGATGAGGTGGG + Intronic
1023246603 7:38211538-38211560 GGAAATGAAATTGAATAGGTAGG + Intronic
1023254700 7:38301598-38301620 GGAGATAAAAATGTAGTGGTAGG - Intergenic
1023381595 7:39613724-39613746 GGAAAGAAAAAAAGGGAGGTGGG - Intergenic
1023518819 7:41030454-41030476 GAAAATACACATAAAGAGGATGG + Intergenic
1023531010 7:41154410-41154432 GAAAAAAAAAATAAAGATGATGG - Intergenic
1024087575 7:45908891-45908913 AAAAATAAAAATAAAGAGCCAGG - Intergenic
1024117976 7:46210852-46210874 GGAAATAAAAATAAATGAATTGG + Intergenic
1024164635 7:46718703-46718725 AAAAATAAAAAAAAAGAGCTGGG + Intronic
1024296690 7:47849328-47849350 GAAAACAAAAATAAATAGATAGG + Intronic
1024404663 7:48964406-48964428 GGAAATAAAAATAAAAATGTTGG - Intergenic
1024881365 7:54088949-54088971 AGAAGCAAAAATAAAGAAGTTGG - Intergenic
1026415975 7:70181420-70181442 TGAAATAAAAATAAGAAGATAGG - Intronic
1026570012 7:71521223-71521245 GGAAAAAAAAAAAAAGATTTGGG - Intronic
1026760500 7:73122598-73122620 GAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1026875677 7:73877784-73877806 AAAAAGAAAAAGAAAGAGGTCGG - Intergenic
1026963371 7:74423988-74424010 ATAAATAAAAATAAAGAGTGGGG + Intergenic
1026990589 7:74583016-74583038 TTAAATAAAAAGAAAGAGGTAGG + Intronic
1027036842 7:74931419-74931441 GAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1027086721 7:75270040-75270062 GAAAAAAAAAAGAAAGAGGCTGG - Intergenic
1027159202 7:75790046-75790068 GGAAAGAAAGAAAGAGAGGTAGG - Intergenic
1027181111 7:75940058-75940080 TAAAATAAGAGTAAAGAGGTGGG - Intronic
1027278176 7:76583774-76583796 GGAAAGAAAAAAAAAAAGATAGG + Intergenic
1027364236 7:77440648-77440670 GGAAATAAGGATGAAGAGGCAGG + Intergenic
1027415557 7:77970295-77970317 ATAAAATAAAATAAAGAGGTTGG - Intergenic
1027516157 7:79144855-79144877 GGAAAGATAAATAGAGGGGTTGG - Intronic
1027860961 7:83580478-83580500 GGCAGTGAAAGTAAAGAGGTAGG - Intronic
1027904860 7:84166275-84166297 GGAAAAAAAAAAAAAGAGGCCGG + Intronic
1028174011 7:87631689-87631711 AGATATAAAAATAAAGAGGCCGG - Intronic
1028199750 7:87947516-87947538 GTAAAAAAAAAAAAAGTGGTGGG + Intronic
1028538506 7:91916145-91916167 GGAAAGAAAATAAAAGAGGGAGG + Intergenic
1028879992 7:95869468-95869490 TGAAAAAAAAAAAGAGAGGTGGG - Intronic
1028919060 7:96290596-96290618 GGAAAAAAAAAAAAAAAGGCAGG + Intronic
1028934851 7:96453465-96453487 GGAAAAAAAAAAAAAGAATTTGG + Intergenic
1028976802 7:96923759-96923781 GGAAATGAGAATAGAGAGGAAGG - Intergenic
1028981718 7:96974492-96974514 GGGAAGAAATATAAGGAGGTAGG + Intergenic
1028982772 7:96984902-96984924 GGAAAAAAAAAAAAAAAGGAAGG - Intergenic
1029145240 7:98441116-98441138 GTAAAAAAAATAAAAGAGGTGGG + Intergenic
1029159201 7:98539729-98539751 AAAAATAAAAATAAATAGCTGGG - Intergenic
1029185671 7:98736722-98736744 AAAAATAAAAATAAAAAGGCTGG + Intergenic
1029214875 7:98940445-98940467 GGGACTAAAAATAAACAGGCTGG - Intronic
1029304056 7:99605904-99605926 GGAAAATTAAATAAAGATGTGGG + Intronic
1029571843 7:101375079-101375101 ATAAATAAAAAAAAAGAGGAAGG + Intronic
1029698447 7:102230013-102230035 GGAAATAAAGATAGAAAGGGTGG - Intronic
1029706452 7:102279042-102279064 AAAAATAAAAATAAATAGGCTGG + Intronic
1030505255 7:110413903-110413925 GGAAATAAAACTGAAGAGACTGG - Intergenic
1030564292 7:111133532-111133554 AGAAAGAAAAATCAGGAGGTGGG + Intronic
1030580317 7:111347044-111347066 GGAAAAAAAAGAAGAGAGGTGGG + Intronic
1030781840 7:113610652-113610674 TAAAAAAAAAATAAAGAGGAAGG + Intergenic
1031109111 7:117584182-117584204 AGAAACAAAAATAAATAGATGGG - Intronic
1031216163 7:118895024-118895046 GGAAAGAAAAAGATTGAGGTAGG + Intergenic
1031333153 7:120491708-120491730 TGAAATAAAAATGAAGAAATTGG - Intronic
1031440322 7:121786824-121786846 GTTAATAAAAATATAAAGGTTGG - Intergenic
1032038553 7:128538679-128538701 AAAAAAAAAAAAAAAGAGGTAGG - Intergenic
1032054258 7:128672171-128672193 GGAAAAAAAAAAGAAGAGGAAGG - Intergenic
1032365620 7:131296715-131296737 AAAAATGAAAATAAAGAGATGGG - Intronic
1032596802 7:133249393-133249415 GGAAATAAAAATTAAAACCTAGG - Intergenic
1032633319 7:133678598-133678620 AGAAAAAAAAAAAAAGAGGGTGG - Intronic
1032938261 7:136758862-136758884 GGATGTAAAAATAAAAGGGTTGG + Intergenic
1033133531 7:138765908-138765930 GAAAATAAAAATAATCAGCTGGG - Intronic
1033207433 7:139435076-139435098 CGCAATAAAAATAAAGTAGTAGG - Intergenic
1033243068 7:139696703-139696725 GGACATAAAAGTAAAGGGGGCGG + Intronic
1033277646 7:139984695-139984717 AGAAAGAAAAAGAAAGAGGAAGG + Intronic
1033343469 7:140509686-140509708 AAAAATAAAAATAAAAAGGCCGG - Intergenic
1034077578 7:148247516-148247538 GCAAAGAAAAACAAAGATGTGGG - Intronic
1034082047 7:148288084-148288106 GAAAAGAAAAAAAAAAAGGTTGG - Intronic
1035187383 7:157137232-157137254 AAAAATAAAAATAAACAGGCCGG - Intergenic
1035348365 7:158224302-158224324 GAAAATAAAAATAAAGTGGAAGG + Intronic
1035687555 8:1536779-1536801 GGAAATAAAAATAAAGAGGTGGG - Intronic
1035691929 8:1565501-1565523 GGAAATGAATATAAAAATGTTGG - Intronic
1035715709 8:1753229-1753251 CCTAATAAAAATAATGAGGTGGG - Intergenic
1036065103 8:5371230-5371252 GGAGATAAAAATACAGGGCTGGG - Intergenic
1036067351 8:5396714-5396736 GGAAATAAAGTTATATAGGTTGG + Intergenic
1036080527 8:5550349-5550371 TGAAATAAAAATAAAAAAGTGGG - Intergenic
1036544878 8:9758162-9758184 GGAAATGTAAATAAAGTGCTCGG + Intronic
1037055385 8:14433978-14434000 AAAAATAAAAATAAATAGCTGGG - Intronic
1037267498 8:17081319-17081341 ACAAGTAAAAATAAAAAGGTTGG - Intronic
1037350159 8:17944689-17944711 GAAAATAAAAATATCTAGGTAGG - Intronic
1037543324 8:19893226-19893248 GGAAAAAAAAATCAAAAAGTGGG + Intergenic
1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG + Intergenic
1037678314 8:21071496-21071518 GGGAAAAAAAAGAAAGGGGTGGG - Intergenic
1037782593 8:21880638-21880660 AGAAATAGAAAGAAAGAGGAAGG + Intergenic
1038081749 8:24145232-24145254 AGAAACAAAAATAAACAAGTGGG - Intergenic
1038133701 8:24762751-24762773 GGAAAGAATACTGAAGAGGTGGG - Intergenic
1038296198 8:26292176-26292198 GGAAAAAAAAATAAAGGCGGGGG - Intronic
1038518696 8:28210322-28210344 GAAAAAAAAAATTAAGAAGTAGG + Intergenic
1038685074 8:29708862-29708884 AAAAAACAAAATAAAGAGGTTGG + Intergenic
1038820895 8:30951107-30951129 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1038979335 8:32740183-32740205 AAAAAAAAAAAAAAAGAGGTTGG - Intronic
1039222174 8:35344379-35344401 TGAAATAAAGATATAGAGGAGGG - Intronic
1039225656 8:35385455-35385477 AAAAAAAAAAAAAAAGAGGTAGG - Intronic
1039361700 8:36884073-36884095 GGAATTAATAATAAAGAGGTGGG - Intronic
1039369635 8:36971763-36971785 AGAAAAAAAATTATAGAGGTGGG - Intergenic
1039402477 8:37281554-37281576 GGAAAAAAAAAAAAAAAGGCAGG + Intergenic
1039444978 8:37623728-37623750 ATAAATAGAAATAAAAAGGTGGG + Intergenic
1039577169 8:38632860-38632882 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1039664773 8:39513024-39513046 AAAAATAAAAATAAATTGGTGGG + Intergenic
1039762445 8:40591976-40591998 GGAAAAAAAAAAATAGAGGGAGG + Intronic
1040711816 8:50198025-50198047 GGAAATAAATATAATGACATTGG - Intronic
1040805950 8:51396458-51396480 GGATTTAAAAATAAACAGGCTGG + Intronic
1041066701 8:54089621-54089643 CAAAAAAAAAAAAAAGAGGTTGG - Intronic
1041169525 8:55127233-55127255 GAAAAAAAAAAAAAAGAGTTAGG - Intronic
1041210938 8:55550142-55550164 GGAATTCAAAATACAGAGATAGG - Intergenic
1041473122 8:58233280-58233302 GGAAATAAAAATAAAGCCCCTGG + Intergenic
1041488685 8:58408363-58408385 ATAAATAAAAATAAAGAGCCTGG + Intergenic
1041552660 8:59119148-59119170 GAAAAAAAAAAAAAAGAGGGGGG + Exonic
1041659191 8:60384517-60384539 GGAGAAAAGAAGAAAGAGGTTGG - Intergenic
1041691542 8:60692898-60692920 AGAAATAAGAATACAGACGTAGG - Intronic
1041836394 8:62221160-62221182 TGAAAGAAAAATAAAGACTTAGG + Intergenic
1041940281 8:63380180-63380202 GGAAATATCAATAAAGAGCTAGG - Intergenic
1042141141 8:65679955-65679977 GGAAATGTAAATAAAAAGGATGG - Intronic
1042493372 8:69428296-69428318 ATAAATAAAAATAAAGGGGCCGG + Intergenic
1042883517 8:73521724-73521746 GGAAAAACAACTAATGAGGTAGG + Intronic
1043008703 8:74855193-74855215 AGAAAGAAAAATAGAGAAGTTGG - Intergenic
1043096006 8:75973639-75973661 GGAAAAGAAAATGAAGAGGAAGG + Intergenic
1043234380 8:77843157-77843179 GGAAAGAAAAATAAAGACACAGG - Intergenic
1043272942 8:78356675-78356697 AAAAATAAAAATAAATGGGTTGG + Intergenic
1043349731 8:79345523-79345545 AGACATGAAAATCAAGAGGTGGG + Intergenic
1043781693 8:84344490-84344512 GAAAGTAAATATAATGAGGTAGG - Intronic
1044107483 8:88228997-88229019 GAAAATAAAAAAAAAAATGTTGG + Intronic
1044119164 8:88373291-88373313 GGAAAAAAAGATAAATAGCTAGG - Intergenic
1044291375 8:90474747-90474769 GGAAAGAAAAATAAACATGGAGG - Intergenic
1044337899 8:91009819-91009841 TGAAATAAAAATGAAGAGAAAGG - Intronic
1044560944 8:93611524-93611546 AAAAATAAAAATAAAGAAATAGG + Intergenic
1044563414 8:93636987-93637009 GGAATTAAAGATAAAAAGCTAGG - Intergenic
1044891955 8:96845808-96845830 AAAAATAAAAATAAAAAGTTAGG - Intronic
1045029208 8:98118719-98118741 GGAAAGAAAAAAAATGAGGCCGG - Intronic
1045099535 8:98830241-98830263 GTAAATAAAAATAAAGTGGAGGG + Intronic
1045100770 8:98841715-98841737 AAAAATAAAAATAAAAAGTTTGG + Intronic
1045114710 8:98970526-98970548 GAAAATACAGCTAAAGAGGTAGG - Intergenic
1045441570 8:102218419-102218441 AGAAAGAAAAATAAATAGGCTGG + Intronic
1045684698 8:104700496-104700518 GAAAATAAACATAAAGTTGTTGG + Intronic
1045713522 8:105014571-105014593 GGCAATAAAAATATAAAGTTGGG - Intronic
1045818776 8:106309906-106309928 AGGAATAAGAATAGAGAGGTGGG - Intronic
1045821295 8:106341865-106341887 GAAAAAAAAAAAATAGAGGTGGG - Intronic
1046044268 8:108945512-108945534 GGAATTAAAAATGAAGATTTGGG - Intergenic
1046275071 8:111948441-111948463 GGGAAAAAAAATAAAGAGAAAGG + Intergenic
1046280789 8:112027887-112027909 GCACATAAAAATAAAGAAATAGG - Intergenic
1046409985 8:113829020-113829042 GCAAAAAAACATAAAGAGGTAGG - Intergenic
1046691600 8:117291798-117291820 GGAAATAAAAATCAAAATTTAGG + Intergenic
1046914003 8:119660177-119660199 GGAAATGAAAACAAAGAGTGTGG - Intronic
1046953907 8:120044143-120044165 ATAAATAAAAATAAAAAGCTTGG - Intronic
1046959599 8:120096357-120096379 GGAAAGAAAAAGAAAGGGGGTGG - Intronic
1047942990 8:129844545-129844567 GGAAAGAAAAAAAGAGAGCTGGG - Intronic
1048040048 8:130718387-130718409 TGCAATAAAGATAAAGAGTTGGG + Intergenic
1048055030 8:130855068-130855090 GGAAATTAAAGGAAAGAGCTGGG + Intronic
1048102108 8:131364181-131364203 GGAAATAAAAATAAACATGGAGG + Intergenic
1048200226 8:132367242-132367264 GGAAAAAAAAATACTGATGTGGG - Intronic
1048200329 8:132368490-132368512 AAAAATAAAAATAAACAGCTGGG + Intronic
1048417402 8:134242832-134242854 TGAAAAAAAAACAAAGAGGGAGG - Intergenic
1048643685 8:136393326-136393348 GTAAATAAACATAAAAAGCTTGG + Intergenic
1048797266 8:138162577-138162599 GTAAAGGAAAATAAAGAGGAAGG - Intronic
1048919551 8:139215444-139215466 GAAAAAAAAAATGAGGAGGTTGG + Intergenic
1049106701 8:140618321-140618343 GGAAAAAAAAAAAAAAAAGTTGG + Intronic
1049439685 8:142603602-142603624 GTAAATATATATAAAAAGGTCGG - Intergenic
1049904551 9:203720-203742 GGAAACCATAATAAAGATGTGGG + Intergenic
1050044279 9:1527142-1527164 GGAAATAAGAAGAGGGAGGTTGG + Intergenic
1050106678 9:2173009-2173031 GGGAATAAATATTCAGAGGTAGG + Intronic
1050136607 9:2472422-2472444 GGAAAGAAATATAAAGATATTGG + Intergenic
1050159679 9:2704798-2704820 GGCAAAAAAAAAAAAAAGGTGGG - Intergenic
1050444093 9:5700010-5700032 GGAAAAAAAAAAAAAAAAGTAGG - Intronic
1050469699 9:5973935-5973957 GAAAGTAAGAATAGAGAGGTAGG + Intronic
1050471786 9:6000520-6000542 GGAAATAAAAATAAATACAAGGG + Intronic
1050873380 9:10604462-10604484 AAAAATAAAAATAAAAAGGAAGG + Intronic
1050913805 9:11106806-11106828 GGAAATAAAAAAAAGGAAGTTGG + Intergenic
1051021649 9:12551858-12551880 AGAAAGAAAAAGAAAGAGGTAGG + Intergenic
1051050068 9:12922005-12922027 GGAAATAAAGATAAAAAAGATGG + Intergenic
1051209191 9:14723556-14723578 GGAAAAAAAAATCAATAGGATGG - Intergenic
1051700737 9:19820553-19820575 ATAAATAAAAATAAAGAGTTAGG + Intergenic
1051708468 9:19905399-19905421 GAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1052464837 9:28817332-28817354 AGAAATAAAAATAGATTGGTTGG + Intergenic
1052468482 9:28861846-28861868 TGAAATAAATATAAAGAAGTTGG + Intergenic
1052672520 9:31576510-31576532 GCATATAAAAATAAATAGATTGG - Intergenic
1052902568 9:33806216-33806238 TTAAATAAAAAAAAAGAGTTGGG - Intergenic
1053004948 9:34598311-34598333 AAAAATAAAAATAAAGGGCTGGG + Intergenic
1053110913 9:35459339-35459361 GGAAAAAGAAAAAAAGAGGTGGG - Intergenic
1053125281 9:35575968-35575990 CGAAATAAAAATAAAATGATTGG - Intergenic
1053148996 9:35731208-35731230 GCAGATAAAATTTAAGAGGTTGG - Intronic
1053404694 9:37862464-37862486 GGAATCAAGAGTAAAGAGGTAGG + Exonic
1053553052 9:39104314-39104336 GGAAATAATTCTAAAGAGGCAGG + Intronic
1053727122 9:41015294-41015316 GGAAACCATAATAAAGATGTGGG + Intergenic
1055099169 9:72445508-72445530 GGAATTAAAAGTTAAGAGGGTGG + Intergenic
1055122033 9:72671606-72671628 AGAAATAAAAATTAAATGGTAGG + Intronic
1055186755 9:73466008-73466030 GAAAACAAAGATAAATAGGTGGG - Intergenic
1055419850 9:76127787-76127809 GGTAATGGAAATAAAGAGCTTGG - Intronic
1055512979 9:77013488-77013510 GTAAAGAATATTAAAGAGGTGGG - Intergenic
1055884621 9:81046352-81046374 GAAAATAAAAATACATACGTAGG + Intergenic
1055896466 9:81182187-81182209 GACAATAAAAAGATAGAGGTAGG + Intergenic
1056251746 9:84755518-84755540 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1056482672 9:87021557-87021579 GTAAAAAAAAAAAAATAGGTGGG - Intergenic
1056833175 9:89932939-89932961 GCAAACAAAACCAAAGAGGTTGG + Intergenic
1057012931 9:91622365-91622387 GGAAAGAAAGAAAAAGAGGAAGG + Intronic
1057160017 9:92882831-92882853 GGAACTAATAATAAAAAGGAAGG - Intergenic
1057239563 9:93396786-93396808 AAAAATAAAAATGAAGGGGTGGG + Intergenic
1057759117 9:97858661-97858683 GGTAAGAAAAATAAAGAGGGAGG + Intergenic
1057971340 9:99561234-99561256 AGGAATCAAAGTAAAGAGGTAGG + Intergenic
1057989066 9:99748786-99748808 GGAAAAAAAAAAAAAAAGGAAGG + Intergenic
1058105866 9:100971186-100971208 GGAAAAAAGAACAAAGAGGAGGG + Intergenic
1058150224 9:101455485-101455507 AGAAATTAAAATAAAGAGCTTGG - Intergenic
1058303694 9:103409274-103409296 GGAAGTATAAAGAAAAAGGTTGG + Intergenic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1058594031 9:106595667-106595689 GAAAATAAGATTAGAGAGGTAGG + Intergenic
1058630411 9:106980655-106980677 GGACATAAAACCGAAGAGGTTGG - Intronic
1059011322 9:110464729-110464751 TTAAATAAAACTATAGAGGTAGG + Intronic
1059093741 9:111390105-111390127 GGAAACAAAGAAAAAGAGGTAGG + Intronic
1059141794 9:111859915-111859937 TGAAATAATAATAAAAAGGCTGG - Intergenic
1059185068 9:112260704-112260726 GGTAATGAAGATAAAGAGATGGG + Intronic
1059292606 9:113240193-113240215 GCAAATAAATATATATAGGTAGG - Intronic
1059319719 9:113459740-113459762 AAAAATAAAAAAAAAGAGGCCGG + Intronic
1059352903 9:113678151-113678173 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1059422291 9:114199756-114199778 GGAAACAAAGATGAACAGGTTGG - Intronic
1059511278 9:114850441-114850463 GAAAATAAAAAAAAAAGGGTTGG + Intergenic
1059558540 9:115307913-115307935 GGAAATAAAATTTAAGATGTGGG + Intronic
1059606056 9:115837634-115837656 GGAAAAAAAAATGAATAGGAGGG + Intergenic
1059800678 9:117746600-117746622 GATAATAATAATAAAGGGGTGGG - Intergenic
1059816126 9:117917683-117917705 GGAAAGAAAATTAGAGAGGGAGG + Intergenic
1059845336 9:118269373-118269395 GAAAATGTAAATAAAAAGGTGGG - Intergenic
1059849424 9:118320777-118320799 AAAAATAAAAATAAAAAGGCGGG + Intergenic
1060017328 9:120098141-120098163 GGAAAAAAAAAGACAGAGGGTGG + Intergenic
1060346250 9:122818288-122818310 ATAAATAAAAATAAAGAGACTGG + Intronic
1060447322 9:123702357-123702379 GTAGAGAAAGATAAAGAGGTAGG + Intronic
1060500391 9:124149374-124149396 GAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1060638778 9:125221194-125221216 ATAAATAAAACTAAAAAGGTAGG + Intronic
1061044600 9:128158189-128158211 AAAAAAAAAAAAAAAGAGGTAGG + Intergenic
1061131543 9:128711300-128711322 AAAAAAAAAAAAAAAGAGGTGGG - Intronic
1061310750 9:129760660-129760682 ATAAATAAAAATAAACAGGCCGG + Intergenic
1061663954 9:132149400-132149422 AAAAATAAAAATAAATAGCTGGG - Intergenic
1062006574 9:134241353-134241375 GAAAAAAAAAAAAAAGAGGCAGG + Intergenic
1185557185 X:1030673-1030695 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1185669643 X:1797389-1797411 TAAAATAAAAATAAAGAGAAAGG - Intergenic
1185789648 X:2919169-2919191 CAAAATAAAAATAAAGTGGCAGG + Intronic
1185804516 X:3045146-3045168 AAAGAGAAAAATAAAGAGGTGGG + Intronic
1186153320 X:6699704-6699726 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1186310453 X:8312078-8312100 ATAAATAAAAATAAAGAAATCGG + Intergenic
1186316877 X:8380431-8380453 GGAAAAAAAAAATAAGAGGAAGG + Intergenic
1186476879 X:9864520-9864542 AAAAATAAAAATAAATAGGCCGG + Intronic
1186687755 X:11943358-11943380 GTAAATAAAAATAAATAGTATGG - Intergenic
1186693923 X:12008615-12008637 TGAAATAAGAATTAAGATGTTGG + Intergenic
1187036070 X:15541041-15541063 GGAAAAAAAAAAAAAAAGATAGG + Intronic
1187104332 X:16224482-16224504 GGAAGCAAAAATACAGAGGGAGG + Intergenic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1187294802 X:17988547-17988569 AGAAATAAAAAAAAAAAGATAGG + Intergenic
1187498043 X:19813318-19813340 GGAAAAAAAAAAAAAGAAATGGG - Intronic
1187657397 X:21492936-21492958 GGAAAGAAATAGAAAGCGGTGGG + Intronic
1187685594 X:21812731-21812753 AGAAAGAAAAAAAAAGAGGGAGG + Intergenic
1187726473 X:22208413-22208435 GTAAGTGAAAAGAAAGAGGTAGG - Intronic
1187793759 X:22979203-22979225 GGAAAACAAAAAGAAGAGGTTGG - Intergenic
1187904550 X:24053852-24053874 GGAAATAAATATTATGAGGCCGG - Intergenic
1188160687 X:26798177-26798199 GCACATAAAAATTAAAAGGTAGG - Intergenic
1188679524 X:32984553-32984575 GGAAAGTAAAACACAGAGGTGGG - Intronic
1188699208 X:33237225-33237247 AGAAAGAAAAAGAAAGAGGGAGG - Intronic
1188779015 X:34256974-34256996 GTATACAAAAATAAACAGGTGGG + Intergenic
1188886492 X:35557039-35557061 GGAAAGGAAAATAAAGAGAGGGG - Intergenic
1189078563 X:37943921-37943943 AGAGAAAAAAATAAAGGGGTAGG - Intronic
1189141167 X:38607862-38607884 GAAAAAAAAAAAAAAAAGGTGGG + Intronic
1189412597 X:40786492-40786514 GGAAATAAAAGTGATGAGGAGGG - Intergenic
1189486447 X:41436395-41436417 TCAAAAAAAAAAAAAGAGGTGGG + Intergenic
1189549163 X:42075366-42075388 AGAAATAAGGCTAAAGAGGTTGG + Intergenic
1189671316 X:43413267-43413289 ATCAATTAAAATAAAGAGGTTGG - Intergenic
1189672005 X:43421000-43421022 GCAAACAAAAATAAAAAGGCAGG + Intergenic
1189809457 X:44767463-44767485 GAAAACAAAAATAGAGAAGTGGG + Intergenic
1189853347 X:45198819-45198841 GGAAATAAATATGCAGATGTTGG - Intronic
1190030394 X:46966801-46966823 GGGAATAAAGGTAGAGAGGTTGG + Intronic
1190232776 X:48595188-48595210 TTAAAAAAAAAAAAAGAGGTCGG - Intronic
1190752165 X:53372160-53372182 GGACATAAAAACAAGAAGGTGGG - Intergenic
1191086029 X:56568310-56568332 GGAAATAAATATAAAATTGTAGG + Intergenic
1191609884 X:63101363-63101385 GAAAATAAAAATAAAAAGAAAGG + Intergenic
1192180419 X:68912457-68912479 GGAGAGAGAAATAAAGGGGTGGG - Intergenic
1192214503 X:69149302-69149324 AGAAAAAAAAAAAAAAAGGTGGG - Intergenic
1192314522 X:70041625-70041647 GGAAGGAAAAAAAAGGAGGTGGG + Intronic
1192773931 X:74222440-74222462 AAAAATAAAAATAAAAAGGTTGG + Intergenic
1192781251 X:74295829-74295851 AAAAAAAAAAAAAAAGAGGTGGG + Intergenic
1192865139 X:75123042-75123064 GGAAGCAAAAATAAACAAGTAGG - Intronic
1192874294 X:75211555-75211577 GGAAAGAAAGAAAAAGAGGATGG + Intergenic
1193000399 X:76556667-76556689 GGAAGTAAAAGTAGAGAGTTGGG + Intergenic
1193219530 X:78906996-78907018 GGAAAAAAAAATGAAGAAATGGG - Intergenic
1193223518 X:78954962-78954984 GGAGAGAAAAATAAAGAGGGTGG - Intronic
1193300148 X:79880064-79880086 AAGAATAAAAATAAAGAAGTAGG + Intergenic
1193364379 X:80613644-80613666 AAAAACAAAAATAAAAAGGTGGG + Intergenic
1193390773 X:80926128-80926150 GAAAACAAAAATAAATAGATGGG + Intergenic
1193408547 X:81134680-81134702 GAAAATAAAAATAAAGTTGAAGG + Intronic
1193484411 X:82069088-82069110 TGGAATAAAAACAAAGAGGTTGG + Intergenic
1193492741 X:82169018-82169040 AAAAAAAAAAAAAAAGAGGTCGG + Intergenic
1193530776 X:82651291-82651313 CAAAATAAAAGTAAAGAGTTGGG + Intergenic
1193559001 X:82994436-82994458 TGAAAAAAAAATAATGAGATAGG - Intergenic
1193561006 X:83015330-83015352 AGAAATGAAAGTAAAGAGTTGGG + Intergenic
1193688506 X:84609369-84609391 AAAAACAAAAATAAATAGGTGGG + Intergenic
1193785758 X:85757865-85757887 TGAAAAAAAAATACAAAGGTGGG - Intergenic
1193972552 X:88073865-88073887 GTAAAGAAAGAGAAAGAGGTCGG + Intergenic
1193974196 X:88097596-88097618 CAAAAACAAAATAAAGAGGTCGG + Intergenic
1194099075 X:89679476-89679498 GGAAAAAAAAATCAAAAAGTGGG + Intergenic
1194122611 X:89978209-89978231 GGAAAGATAAATTTAGAGGTTGG - Intergenic
1194253560 X:91608086-91608108 AGAAATAAAATTAAATAGCTAGG + Intergenic
1194482255 X:94440996-94441018 GGAAAAAAAAAAAAAGGGATGGG - Intergenic
1194644002 X:96436105-96436127 GTATATAAAAATAAAGAGTAAGG + Intergenic
1194737566 X:97530806-97530828 TTAAAAAATAATAAAGAGGTAGG + Intronic
1195277384 X:103295046-103295068 GCAAAAAAAAAAAAAAAGGTGGG + Intergenic
1195373432 X:104202333-104202355 AAAAATAAAAATAAATAAGTAGG - Intergenic
1195390287 X:104354800-104354822 AAAAATAAAAATAAAAAAGTAGG - Intergenic
1195463208 X:105150873-105150895 GGAAAAAAAAATCAAGTGATAGG + Intronic
1195518660 X:105806312-105806334 GGAAAAAAAAATCAAAAAGTGGG - Intergenic
1195566663 X:106347068-106347090 GGAAAGAAAAAAAAAAAGGAAGG - Intergenic
1195789794 X:108571384-108571406 GGAGTTAAAAATAAAGAGCATGG - Intronic
1195827914 X:109023137-109023159 GGAAAGCAAAAAAAAGAGGGAGG - Intergenic
1196050510 X:111298910-111298932 GGGAAGAAAAATCAGGAGGTAGG + Exonic
1196142282 X:112277034-112277056 GGAAATAAAAAATAAGACTTTGG + Intergenic
1196147596 X:112336093-112336115 GCAATTAAAAATAAAGATTTTGG - Intergenic
1196261803 X:113591707-113591729 ACAAATAAAAATAAATAGGATGG - Intergenic
1196322858 X:114363250-114363272 GGCAATAAGAATGAAGAGGAAGG + Intergenic
1196364244 X:114905800-114905822 GGAAATATCAATGAGGAGGTGGG - Intronic
1196637754 X:118022841-118022863 AGAAACAAAAATAAACAAGTTGG - Intronic
1196673153 X:118390774-118390796 AGAAATAACAATAAATATGTAGG - Intronic
1196675267 X:118413697-118413719 TGCAATAAAAATAAATAGTTGGG - Intronic
1196758404 X:119178008-119178030 AAAAAAAAAAAAAAAGAGGTGGG - Intergenic
1196861768 X:120035468-120035490 GGAAAAAAAATTAAAGGTGTGGG - Intergenic
1196911943 X:120492772-120492794 AAAAAAAAAAAAAAAGAGGTTGG - Intergenic
1197214821 X:123858336-123858358 GTAAATAAAAATAAATAGGCCGG - Intergenic
1197471789 X:126872324-126872346 GAAAACAAAAATAAACAGATGGG - Intergenic
1197956357 X:131953191-131953213 AAAAACAAAAATAAAGAGCTGGG - Intergenic
1198007207 X:132507611-132507633 GAAAATAACAATAAAGTGGCGGG + Intergenic
1198102603 X:133435253-133435275 AAAAATAAAAATAAATAGCTGGG - Intergenic
1198452061 X:136776922-136776944 AGAAATAAAAATAAACAAATAGG + Intronic
1198472258 X:136958371-136958393 GGAAATTAAAATAAGAAGGCTGG + Intergenic
1198585790 X:138120145-138120167 AGAAGCAAAAATAAAGAAGTAGG - Intergenic
1198620151 X:138499079-138499101 GGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1198699235 X:139380078-139380100 GGAAAGAAATACAAAGATGTAGG - Intergenic
1198709397 X:139484940-139484962 AGAAATAAAAAGACAGAAGTGGG - Intergenic
1198891296 X:141400183-141400205 GGAAAAAAAAAAGCAGAGGTTGG - Intergenic
1199058237 X:143323199-143323221 GTAAAAAAAAAAAAAGAAGTAGG + Intergenic
1199275407 X:145936444-145936466 GCAAAAAAAAAAAAAAAGGTGGG - Intergenic
1199478299 X:148270383-148270405 GGAATTAAAAATGAGGAGTTAGG + Intergenic
1199699836 X:150366849-150366871 GAAAAAAGAAAGAAAGAGGTGGG + Intronic
1199992726 X:152997032-152997054 AAAAAAAAAAAAAAAGAGGTCGG - Intergenic
1200144049 X:153916917-153916939 AAAAATAAAAATAAAAGGGTCGG + Intronic
1200208421 X:154334066-154334088 GGAGGCAAAAATAAAGATGTTGG + Intergenic
1200284676 X:154808803-154808825 AAAAACAAAAATAAATAGGTGGG + Intronic
1200416318 Y:2915301-2915323 TGAAAAAGAAATAAAGGGGTTGG + Intronic
1200475471 Y:3635648-3635670 GGAAAGATAAATTTAGAGGTTGG - Intergenic
1200549608 Y:4561276-4561298 GGAAAAAAAAAAAAAAAGGAGGG + Intergenic
1200572342 Y:4847667-4847689 AGAAATAAAATTAAATAGCTAGG + Intergenic
1200881489 Y:8217413-8217435 GGAAAAGAAAAGAAAGAGGAAGG + Intergenic
1201284796 Y:12369714-12369736 CAAAATAAAAATAAAGTGGCAGG - Intergenic
1201303379 Y:12529571-12529593 GTAAATAACAAAAAAGAGGAAGG + Intergenic
1201531629 Y:14996059-14996081 GGAAATGAAAATAAGTATGTAGG - Intergenic
1201692180 Y:16779297-16779319 TCAAAAAAAAAAAAAGAGGTCGG - Intergenic
1201750959 Y:17431645-17431667 GGGAATAGAAATCAAGGGGTAGG - Intergenic
1201764862 Y:17566934-17566956 GGAAAAAAAAAAAAAAAGGCGGG - Intergenic
1201836690 Y:18339055-18339077 GGAAAAAAAAAAAAAAAGGCGGG + Intergenic
1201898351 Y:19018599-19018621 GGAAATAAAAGAAAAGAGAGGGG + Intergenic
1201963937 Y:19710782-19710804 AGAAATAAATACAAATAGGTGGG + Intronic
1202060458 Y:20882127-20882149 AAAAATAAAAATAAAAAGCTAGG - Intergenic
1202331457 Y:23757291-23757313 GTAAATAAAACTACAGAGATGGG + Intergenic
1202371436 Y:24199427-24199449 AGAAATAAAAATAAAAAGGAAGG + Intergenic
1202499349 Y:25470688-25470710 AGAAATAAAAATAAAAAGGAAGG - Intergenic
1202539313 Y:25912769-25912791 GTAAATAAAACTACAGAGATGGG - Intergenic