ID: 1035687594

View in Genome Browser
Species Human (GRCh38)
Location 8:1537017-1537039
Sequence CACACCTCGGAGAAGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035687585_1035687594 11 Left 1035687585 8:1536983-1537005 CCCTCCAAGGCCGGTACAATGAT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG No data
1035687590_1035687594 1 Left 1035687590 8:1536993-1537015 CCGGTACAATGATTACGGGCCCT 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG No data
1035687586_1035687594 10 Left 1035687586 8:1536984-1537006 CCTCCAAGGCCGGTACAATGATT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG No data
1035687584_1035687594 17 Left 1035687584 8:1536977-1536999 CCACGACCCTCCAAGGCCGGTAC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG No data
1035687587_1035687594 7 Left 1035687587 8:1536987-1537009 CCAAGGCCGGTACAATGATTACG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035687594 Original CRISPR CACACCTCGGAGAAGTAGTC AGG Intronic
No off target data available for this crispr