ID: 1035687745

View in Genome Browser
Species Human (GRCh38)
Location 8:1538066-1538088
Sequence CCGAGCCCTGCAGGTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 415}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035687745_1035687750 -5 Left 1035687745 8:1538066-1538088 CCTGGGGCACCTGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 47
4: 415
Right 1035687750 8:1538084-1538106 CTCGGGGCTGCTGATGCTGCTGG No data
1035687745_1035687751 -4 Left 1035687745 8:1538066-1538088 CCTGGGGCACCTGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 47
4: 415
Right 1035687751 8:1538085-1538107 TCGGGGCTGCTGATGCTGCTGGG No data
1035687745_1035687755 29 Left 1035687745 8:1538066-1538088 CCTGGGGCACCTGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 47
4: 415
Right 1035687755 8:1538118-1538140 CACTCATGTCCCATGCAGCATGG No data
1035687745_1035687752 -3 Left 1035687745 8:1538066-1538088 CCTGGGGCACCTGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 47
4: 415
Right 1035687752 8:1538086-1538108 CGGGGCTGCTGATGCTGCTGGGG No data
1035687745_1035687753 6 Left 1035687745 8:1538066-1538088 CCTGGGGCACCTGCAGGGCTCGG 0: 1
1: 0
2: 1
3: 47
4: 415
Right 1035687753 8:1538095-1538117 TGATGCTGCTGGGGCTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035687745 Original CRISPR CCGAGCCCTGCAGGTGCCCC AGG (reversed) Intronic
900341933 1:2193716-2193738 CTGATCCCTGCAGGGCCCCCAGG - Exonic
900386535 1:2413319-2413341 CTGAGCCCCGCAGGTGCTCTGGG + Intronic
900404086 1:2484906-2484928 CCAAGCCATTCAGGGGCCCCTGG - Intronic
900429842 1:2596352-2596374 CTGAGCCCTGCAGGTCCAGCTGG - Intronic
900466916 1:2830210-2830232 CTGAGCTCTGGGGGTGCCCCAGG + Intergenic
900477204 1:2881609-2881631 CCGAGAGCTCCAGGTGTCCCAGG + Intergenic
900545954 1:3229337-3229359 CCCACACCTGCAGGTGCCCCGGG + Intronic
900603278 1:3512286-3512308 CACAGCCCTGCAGGTCCCCTGGG + Intronic
900644442 1:3702633-3702655 CCAGGCCCTGCTGGGGCCCCAGG - Intronic
901335824 1:8448136-8448158 CAGAGGCCTCCAGGTGGCCCTGG - Intronic
901616181 1:10541504-10541526 CCGTGCCCTGCAGGTGAGCGAGG + Intronic
901649765 1:10736890-10736912 CCCGGGCCTGCAGGTGCTCCTGG + Intronic
902264053 1:15248417-15248439 CCTTGCCCTGCAAGTACCCCGGG + Intronic
903367778 1:22815561-22815583 CTGAGCCCTGCATTGGCCCCAGG + Intronic
904551743 1:31324759-31324781 CATGGGCCTGCAGGTGCCCCTGG + Intronic
904559292 1:31385981-31386003 CAGAGGCCTGCAGCTGGCCCAGG + Intergenic
905406371 1:37735297-37735319 CCCATCCCTGCCGGAGCCCCTGG - Exonic
907516620 1:54997148-54997170 CCGAGCCCAGCCGCTGACCCCGG + Intergenic
909820493 1:80053690-80053712 TCGAGCACAGCAGGTGGCCCGGG + Intergenic
912737795 1:112165568-112165590 CCTGGCCCTGCAAGAGCCCCAGG + Intergenic
912739649 1:112182338-112182360 CAGTGCCCTGCTGGAGCCCCGGG + Intergenic
914899931 1:151706451-151706473 CTCAGCCCTGCAGGTGCCACTGG - Intronic
915006643 1:152644498-152644520 CTGAGCACTACAGGTGCCACAGG - Intergenic
920366480 1:205450662-205450684 CTGAGCCCTTCATGTGCCCAGGG - Intronic
921098724 1:211910228-211910250 CCTTGCCCTTCAGGGGCCCCTGG + Intergenic
921152794 1:212415008-212415030 CGGAGGCCTGCATGTGACCCTGG + Intergenic
924775215 1:247111486-247111508 CCGAGTCCTCCCGGCGCCCCGGG - Exonic
924797295 1:247301414-247301436 GCCAGCCCTGCAGGGGCCACTGG + Intronic
1062896685 10:1108749-1108771 CAGGGCCCTGCAGGTTCCACGGG - Intronic
1063116523 10:3075650-3075672 CCCAGCCCTTCAGGAGCCCAAGG + Intronic
1064193473 10:13227166-13227188 CATTGCCCTGCAGGTGCACCTGG - Intronic
1066080968 10:31929453-31929475 GCGAGCCCTGCGGGGGCCACAGG + Intergenic
1067713813 10:48671726-48671748 CCGGGCCCTGCAGGTGGGGCCGG - Intergenic
1067792524 10:49298865-49298887 CAGAGCCCTGCTGATGTCCCGGG - Intergenic
1069551099 10:69364923-69364945 TCGGGCTCTGCAGATGCCCCGGG + Intronic
1070290764 10:75111821-75111843 CCGCGACCTGGAGGGGCCCCGGG + Intronic
1070688340 10:78506688-78506710 GAGAGCCCTGCAGGTGCTCTGGG - Intergenic
1071500687 10:86202167-86202189 CCGTGCCCTGGAGATGCCCCTGG + Intronic
1073332405 10:102679042-102679064 CCGAGCCCTGTGGCTGCCCTGGG + Intronic
1073511168 10:104043500-104043522 CCAGGACCTCCAGGTGCCCCAGG - Exonic
1074976078 10:118582747-118582769 GTGAGCCCTGTAGGTGCCTCAGG - Intergenic
1075461404 10:122618875-122618897 CAGAGCACTGCCTGTGCCCCAGG + Intronic
1076581230 10:131513352-131513374 CCGAGCCTTCCAGCTCCCCCTGG + Intergenic
1076805474 10:132855993-132856015 CTGAGCCCTGCAGGAGCTCTTGG - Intronic
1076844231 10:133061088-133061110 GAGGGCCCTGCAGGTGCTCCAGG + Intergenic
1076944641 10:133637792-133637814 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
1076947998 10:133665019-133665041 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076948988 10:133668329-133668351 CCGAGGCCTCCAGCTCCCCCGGG - Intronic
1076949972 10:133671628-133671650 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
1076950956 10:133674927-133674949 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076951946 10:133678237-133678259 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076952935 10:133681547-133681569 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076953919 10:133684846-133684868 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076954903 10:133741198-133741220 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076955892 10:133744508-133744530 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076956882 10:133747818-133747840 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076957869 10:133751127-133751149 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076958854 10:133754426-133754448 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076959843 10:133757736-133757758 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076960827 10:133761035-133761057 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1077014046 11:392230-392252 CCGCGGCCTGCAGGGCCCCCAGG - Intergenic
1077047002 11:551118-551140 CCTCCCCCTGCAGGTGCCCAGGG + Exonic
1077050106 11:562764-562786 GCGAGCCTTGCAGGTGAGCCCGG + Exonic
1077499557 11:2903028-2903050 CCGACCCCTGCAGGTGGGCCAGG - Intronic
1077511100 11:2963579-2963601 CCCACCCCTGCTGCTGCCCCAGG + Intronic
1077535636 11:3122677-3122699 CCCATCCCAGCATGTGCCCCGGG - Intronic
1077563386 11:3280439-3280461 CCAAGCCCTGCAGGTGATGCTGG + Intergenic
1077569278 11:3326254-3326276 CCAAGCCCTGCAGGTGATGCTGG + Intergenic
1080458811 11:32436490-32436512 CCGAGCACTGCCTGTGGCCCTGG + Intergenic
1081644506 11:44780334-44780356 CCAAGCCCAGCAGGGGCTCCAGG + Intronic
1081807665 11:45899306-45899328 CCGAGCTAGGCAGGGGCCCCAGG + Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083924051 11:65795347-65795369 TCGAGCCCTGGGGGTGCTCCTGG + Exonic
1084310171 11:68312392-68312414 CCCTGCCCTGGAGGTGCCTCCGG - Intergenic
1085304600 11:75477939-75477961 CCCACCCCTGCAGGTCCCCAAGG + Intronic
1085307714 11:75497553-75497575 TCGGCGCCTGCAGGTGCCCCAGG + Intronic
1086634608 11:89065952-89065974 CCGAGCGCGGCACGTGCTCCCGG - Intergenic
1089008454 11:115113029-115113051 TCAAGCCCTGCAGGGGCCCAGGG - Intergenic
1089257210 11:117200292-117200314 AGCAGCCCTGCAGGGGCCCCTGG + Intronic
1089346659 11:117795785-117795807 CCCTGCCCTGCCGGTGCTCCAGG - Intronic
1091599323 12:1908482-1908504 CCGAGTCCCGCAGCTGCCCTCGG + Intronic
1092287444 12:7136947-7136969 CCAGGCTGTGCAGGTGCCCCTGG + Exonic
1092926836 12:13279222-13279244 CTGAGACCCGCAGGTGCGCCCGG + Intergenic
1096522389 12:52191698-52191720 CCCCGGCCTGCTGGTGCCCCTGG - Exonic
1101747936 12:107558363-107558385 TCTGGCCCTGCAGGTGCTCCAGG + Intronic
1102458233 12:113084190-113084212 CCCACCCCCGCAGGTCCCCCAGG - Intronic
1102651191 12:114443797-114443819 TCTAGCCCTGCAGGGCCCCCAGG - Intergenic
1103092026 12:118104155-118104177 CGGAGCCCTGCAGCTGCCGCAGG + Intronic
1103367461 12:120393719-120393741 CCCAGCCTTGCAGGTCCCTCAGG - Intergenic
1104042081 12:125137084-125137106 CCCAGCCCTGCAGGTCCAACTGG + Intronic
1104049796 12:125187299-125187321 CCGGGGCCCGCAGGTGTCCCGGG - Intronic
1104477371 12:129081881-129081903 CTGAGCCCAGCAGGTGGGCCAGG + Exonic
1104796863 12:131526220-131526242 CCCAGCCCTACAGGGGCCCAGGG - Intergenic
1104802303 12:131562362-131562384 CACAGCCCTGCATGTGCACCTGG - Intergenic
1104989665 12:132618642-132618664 CCCCGCCCCGCAGGTGTCCCGGG - Intergenic
1105290126 13:19048240-19048262 CCGAGCCCTGCAGCCTCCCAGGG - Intergenic
1105454228 13:20525721-20525743 CCGAGCCGCGCTGCTGCCCCTGG - Intronic
1105834020 13:24192876-24192898 CAGAGCCCAGCAGGTGGTCCTGG + Intronic
1107658207 13:42613424-42613446 TCCAGCCCTGCAGATCCCCCTGG - Intergenic
1113746520 13:112749059-112749081 CCCAGCTCTGCTGGGGCCCCAGG + Intronic
1114267985 14:21083864-21083886 CCGAGCCCTGCAGCAGCCTCTGG + Exonic
1114473743 14:22980766-22980788 CCGGGCGCTCCAGGTGCCCGCGG - Intronic
1115646183 14:35369755-35369777 CAGGGCCCTGCAGGTGCGGCCGG + Intergenic
1118265988 14:64295078-64295100 CCCACCCCAGCAGGAGCCCCAGG + Intronic
1118325134 14:64775271-64775293 AGGAGCTCTGCAGGTGCCCCAGG + Exonic
1118385999 14:65256044-65256066 CACAGCCCTGCAGGTGGCACTGG + Intergenic
1119773314 14:77234839-77234861 CCGAGGCCTGCAGGTAACACAGG + Intronic
1121000720 14:90450380-90450402 CCCAGGGCTGCAGGTGCCCATGG - Intergenic
1122275571 14:100589158-100589180 CAGAGCCCTGCCTGTACCCCAGG - Intergenic
1122710887 14:103656972-103656994 CAGAGCCCTGGAGTGGCCCCTGG + Intronic
1122843343 14:104477271-104477293 CCCAGACCTGAAGCTGCCCCTGG + Intronic
1122978126 14:105179337-105179359 CTGAGGGCTGCAGCTGCCCCTGG + Intronic
1123056634 14:105574035-105574057 CGAAGCCCTGCAGGTTCTCCAGG - Intergenic
1123081576 14:105697750-105697772 CGGAGCCCTGCAGGTTCTCCAGG + Intergenic
1123194843 14:106606390-106606412 CCGACTCCTGCAGCTGCACCTGG + Intergenic
1123197126 14:106627520-106627542 CCGACTCCTGCAGCTGCACCTGG + Intergenic
1123198467 14:106639396-106639418 CCGACTCCTGCAGCTGCACCTGG + Intergenic
1202918022 14_KI270723v1_random:3124-3146 CCGGGGCCTGCAGGTGACCCTGG - Intergenic
1202926605 14_KI270724v1_random:31462-31484 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
1202947412 14_KI270726v1_random:41582-41604 CCGACTCCTGCAGCTGCACCTGG - Intergenic
1123450436 15:20356606-20356628 CCCAGCCCTGGAGGTGCCCTCGG - Intergenic
1123584233 15:21742638-21742660 CCGACTCCTGCAGCTGCACCTGG + Exonic
1123620884 15:22185241-22185263 CCGACTCCTGCAGCTGCACCTGG + Intergenic
1124626836 15:31312534-31312556 CAGAGCCTTGCCGGTGGCCCAGG - Intergenic
1127260404 15:57323073-57323095 TGGACCCCTGCAGGAGCCCCAGG - Intergenic
1127630068 15:60819955-60819977 TCCACCCCTGCAGATGCCCCAGG + Intronic
1128061558 15:64738771-64738793 CCAGGCCCTGCAGGTAACCCTGG - Intergenic
1129162114 15:73752851-73752873 CCCAGCCCGGCCGGGGCCCCCGG - Intergenic
1130276171 15:82477405-82477427 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130468530 15:84204798-84204820 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130495734 15:84468744-84468766 CCGGGCCCTGCAGGGGGCCATGG + Intergenic
1130590823 15:85209397-85209419 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130596841 15:85254911-85254933 CAGAGCCAGGGAGGTGCCCCTGG + Intergenic
1131099808 15:89679096-89679118 CCCAGCACTGCAGGTGGCCAAGG - Intronic
1131188541 15:90294816-90294838 CCGGGCCCTGCAGGGGGCCAAGG + Intronic
1131925580 15:97379722-97379744 CCTAACCCTGCTTGTGCCCCAGG - Intergenic
1132347334 15:101116220-101116242 GCCAGTCCTGCAGGGGCCCCAGG - Intergenic
1132403551 15:101528663-101528685 CCCAGCCCTGCAGCTGGGCCTGG + Intergenic
1132432523 15:101773048-101773070 CCCAGCTCTCCAGGTGCTCCGGG + Intergenic
1132703735 16:1232311-1232333 CCCAGCCCTGCAGCAGCCCCAGG - Intergenic
1132704775 16:1239050-1239072 CCCAGCCCTGCAGCAGCCCCAGG + Intergenic
1132707783 16:1254084-1254106 CCCAGCCCTGCAGCAGCCCCAGG + Intergenic
1132747634 16:1443571-1443593 CTGAGCCCTGCAGCTGCACGCGG + Exonic
1132954216 16:2582604-2582626 CCTGCCCCTGCAGGTGGCCCCGG - Intronic
1132960129 16:2617559-2617581 CCTGCCCCTGCAGGTGGCCCCGG + Intergenic
1133259249 16:4537991-4538013 CCGAGCCCCGCGGGTGACCTTGG - Intronic
1134664639 16:16009925-16009947 CTGAGCCCAGCAGATGGCCCAGG - Intronic
1136477828 16:30524494-30524516 CCCACCCCTGCTGGGGCCCCAGG + Exonic
1136517287 16:30775676-30775698 CAGCGCGCTGCAGGCGCCCCGGG + Exonic
1137000082 16:35221951-35221973 CCAGGGCCTGCAGGTGACCCTGG - Intergenic
1137013161 16:35344461-35344483 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137019867 16:35414648-35414670 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137026911 16:35486132-35486154 CCCGGACCTGCAGGTGGCCCTGG - Intergenic
1137033118 16:35543655-35543677 CCGGGGCCTGCAGGTAGCCCTGG - Intergenic
1139361565 16:66402900-66402922 CCGGGCCCTCCGTGTGCCCCAGG - Exonic
1139466206 16:67155367-67155389 CCTAGCCCAGCAGGTGCGGCCGG - Exonic
1139891626 16:70256775-70256797 CAGAGGCCTGCAGGAGACCCTGG + Intronic
1139956730 16:70696849-70696871 CCCAGCCCGGCAGGTGCCAGCGG - Intronic
1140424744 16:74851358-74851380 CGGGGCCCTGCAGGTGGGCCTGG - Intergenic
1142066941 16:88068155-88068177 CGGAGCTCTGCAGGGGCCACAGG - Intronic
1142222038 16:88860245-88860267 CTGAGTCCTGCAGGTGCCCCAGG - Intronic
1142293022 16:89201362-89201384 CCGCGCCCTGCACCCGCCCCGGG - Intronic
1142338868 16:89508062-89508084 CCGAACCCTGCGGGTGACGCAGG + Intronic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142440804 16:90096472-90096494 CCGAGCCCTCCTGGAGCCACTGG - Intergenic
1142667620 17:1471687-1471709 CCGTGCCCTCCAGGAGCACCCGG - Intronic
1142750691 17:1985759-1985781 ATGAGCCCTGGAGGAGCCCCAGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143328678 17:6118511-6118533 CCCAGCCCTGCATGAGCTCCTGG - Intronic
1143499587 17:7330797-7330819 TCTTGCCCTGCAGGTCCCCCAGG - Intergenic
1144065736 17:11622573-11622595 TCCAGCCCTGCAGATGGCCCTGG + Intronic
1144573473 17:16415258-16415280 CTCAGCCCAGCAGATGCCCCTGG - Intergenic
1144768535 17:17746180-17746202 CCAAGCCCGGCAGATGCCCCCGG + Intronic
1144834120 17:18148098-18148120 CCGAGCCCTGCTGTTGGGCCCGG - Exonic
1145264124 17:21371392-21371414 CTGGGCCCTGGGGGTGCCCCAGG + Intergenic
1145994629 17:29098285-29098307 CCAGCCCCTGCAGGTCCCCCAGG - Intronic
1146947883 17:36886108-36886130 AGGAGCCCTGCAGGTGGCCAGGG + Intergenic
1147170827 17:38617759-38617781 GTGGGCCCTGCAGGTGCCCACGG + Intergenic
1147341267 17:39754457-39754479 CCGCGCGCTGCAGATGCCCGCGG + Intergenic
1147374676 17:40016526-40016548 CCAGGGCCTGCAGGAGCCCCTGG - Exonic
1147741272 17:42672203-42672225 TCGGGCCCTGCAGGTCCCCCCGG - Exonic
1148440959 17:47711379-47711401 CCATGCCCTCCTGGTGCCCCTGG + Exonic
1148794570 17:50190824-50190846 CCTGGCCCTGCTGGTGCCCCTGG - Exonic
1149491069 17:57085496-57085518 ACGCGCCCTCCAGGTACCCCGGG + Intronic
1149776880 17:59365279-59365301 CTGAGACCTGCTGGTCCCCCTGG - Intronic
1149989002 17:61369962-61369984 CCGAGGCCTGGAGGAGCTCCCGG + Intronic
1150266872 17:63837737-63837759 CAGAGCCCTGCTGGAGCCCCAGG + Intronic
1151365386 17:73613361-73613383 CCCCGCCCTCCAGGTCCCCCTGG + Intronic
1151426977 17:74037363-74037385 CCGAGCCCTGCCCAGGCCCCTGG - Intergenic
1151618911 17:75233045-75233067 CCGGGCCCTGCAGGTTCCTCAGG + Exonic
1152157336 17:78643517-78643539 TCGAGCCCCGCAGGCGCCCTCGG - Intergenic
1152207242 17:78980747-78980769 CTGAGCCCTGCGGGGGCCCCGGG + Intergenic
1152231224 17:79115068-79115090 CAGAGCCGTGGAGGTGGCCCAGG - Intronic
1152242497 17:79167792-79167814 ACGGGGCCTGGAGGTGCCCCCGG + Intronic
1152258844 17:79255724-79255746 CCCTGAGCTGCAGGTGCCCCCGG - Intronic
1152336849 17:79703584-79703606 CCCGGCTCTGCAGGTGCCACTGG - Intergenic
1152338006 17:79708733-79708755 CCCAGCCCTGGAGGTGCCCTCGG + Intergenic
1152554366 17:81045700-81045722 CAGGGCCCTGCAGGAGTCCCTGG + Intronic
1152641617 17:81451788-81451810 CCAACCCCTGCAGCGGCCCCAGG + Exonic
1152751794 17:82065708-82065730 CCGGGAGCTGCAGGGGCCCCGGG - Intronic
1152779182 17:82218899-82218921 CCAAGCCCTAGCGGTGCCCCCGG - Intergenic
1152858134 17:82677827-82677849 CCGACCCCTGCACCTGACCCGGG + Intronic
1152965845 18:112500-112522 CCGAGGCCTCCAGCTCCCCCGGG + Intergenic
1154339100 18:13488517-13488539 TGGAGCCCTGCCTGTGCCCCAGG + Intronic
1156551657 18:38025487-38025509 CTGAGTCCTGCAGGTGGCCACGG - Intergenic
1158759485 18:60367790-60367812 CCCAACCCTGCTGGTGGCCCAGG - Intergenic
1159005348 18:63005519-63005541 CCGGGCCCAGCAGGTGCTTCTGG + Intergenic
1159260447 18:66006035-66006057 TCGGGCCCTGCAGGAGCCCACGG + Intergenic
1160017340 18:75154795-75154817 CCAAGGACTGCAGGTGGCCCTGG + Intergenic
1160036067 18:75302753-75302775 CCGAGCCCTCCACATGGCCCAGG - Intergenic
1160530702 18:79560693-79560715 GCCCGTCCTGCAGGTGCCCCCGG + Intergenic
1160544567 18:79644148-79644170 CGGAGGCCTGCAGGTGCCACGGG + Intergenic
1160935462 19:1592586-1592608 CCCAGCCCTGCGGGAGCGCCGGG + Exonic
1160947981 19:1652290-1652312 CCGCGCCCAGCAGGTGAGCCCGG - Exonic
1161014839 19:1978456-1978478 CCGGGCCCCGCAGCTGCACCTGG + Exonic
1161043093 19:2120522-2120544 CTGAGCCTTGCAGATGCCCAGGG + Intronic
1161302222 19:3548194-3548216 ACGAGCCCTGCAGGTGCAGCAGG + Exonic
1161479529 19:4503622-4503644 CTGGGCCCAGCAGCTGCCCCTGG - Exonic
1161531652 19:4793282-4793304 ACGGGCCCTGCAGCTGCCCAGGG + Exonic
1161613627 19:5257674-5257696 CAGAGGCCTGCAGGCTCCCCTGG + Intronic
1161645535 19:5451218-5451240 CCCAGCCCTCAAGGAGCCCCAGG - Intergenic
1162029096 19:7909750-7909772 CCTAGCCCTGCAGCTCCCGCTGG + Exonic
1162489934 19:10986038-10986060 ATGTGCCCTCCAGGTGCCCCTGG + Intronic
1162514286 19:11138817-11138839 CCCTGCCCTGCAGCTGGCCCTGG + Intronic
1162752886 19:12839279-12839301 CCTAGCCTTGCAGCTGCCACAGG + Intronic
1163008926 19:14412797-14412819 CCCAGCCCTGCAGGTGTCTGTGG - Intronic
1163371744 19:16904744-16904766 CCCAGCCCTTCCTGTGCCCCTGG + Intronic
1163444603 19:17339136-17339158 ACGGGCACTGCAGGTGGCCCTGG + Exonic
1164927938 19:32145235-32145257 CAGTGCACTGCAGGTGCTCCGGG - Intergenic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1165177963 19:33943792-33943814 CCTTGCCCTGCAGGTGCTCCCGG - Intergenic
1167304007 19:48696535-48696557 CCGAGCCCTGCCGTCGCCCAGGG + Intronic
1167460419 19:49621610-49621632 CCCAGCCCTGCAGGTGCCTGGGG + Exonic
1167468918 19:49664766-49664788 CCACGCCCTCCAGTTGCCCCAGG + Exonic
1167642161 19:50687857-50687879 CTCAGCCCTGCGGGAGCCCCAGG - Intronic
1167758208 19:51426524-51426546 CCGGGTCCTGGAGCTGCCCCAGG - Intergenic
1168205172 19:54845179-54845201 CCCAGCCCTGCAGGAGGCCAAGG + Intronic
1168279271 19:55295601-55295623 TCAAGCCCTCCAGGTGCTCCTGG - Intronic
1168414223 19:56158708-56158730 CCCAGCCCTTGAGGAGCCCCGGG + Intronic
925169985 2:1744429-1744451 CCAAGCGCTCCAGGGGCCCCGGG - Exonic
925411573 2:3642814-3642836 CCACGGCCTGCAGGTGCTCCTGG + Intronic
926041996 2:9680886-9680908 CTGAGGCCTGCAGGAGCCTCAGG - Intergenic
926161772 2:10494692-10494714 CAGAGCCTTGCAGGTGGGCCAGG + Intergenic
926315224 2:11704763-11704785 CAGAGCCCTGCAGGGGATCCCGG - Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927709391 2:25315315-25315337 CCCAGCCCTGGCTGTGCCCCAGG + Intronic
927851595 2:26503330-26503352 CCGCGCCCTCCAGCGGCCCCAGG + Intronic
928406381 2:31018181-31018203 CAGGGCCCTCCAGGTACCCCTGG + Intronic
929075499 2:38076280-38076302 CCGAGGCCGGCCGGTGCGCCTGG - Intronic
933289364 2:80420713-80420735 TCCAGCACTGCAGGTGCCTCGGG + Intronic
935811813 2:106805880-106805902 CACAGGGCTGCAGGTGCCCCTGG - Exonic
938493473 2:131777997-131778019 CCGTGCCCTGCAGGTCTCACAGG + Intergenic
940640869 2:156342761-156342783 CCGAGTGCTGCCGGGGCCCCGGG + Intergenic
942318972 2:174719126-174719148 CCTAGCACTGCAGGTGGCTCTGG + Intergenic
947142454 2:227032019-227032041 CCTGGTCCTGCAGGTGCCACAGG - Exonic
947549659 2:231037441-231037463 CCGAGCCCAGCCGGACCCCCGGG - Intergenic
947592253 2:231392613-231392635 CGGAGCCCAGCAGGGGCCACGGG - Intergenic
947773515 2:232689634-232689656 CCCAGCCCTGCTGGTGCTTCTGG - Intergenic
948005325 2:234603515-234603537 CCCTGGCCTGCAGGTGTCCCAGG - Intergenic
948591610 2:239054092-239054114 CAGAGCCCTGAAGCTGACCCTGG - Intronic
1170774738 20:19365354-19365376 CCAAGCCCTCCAGGTGAGCCTGG + Intronic
1171201312 20:23244657-23244679 TCGGGCCCTCCAGGTGGCCCAGG - Intergenic
1171781980 20:29427783-29427805 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1171981620 20:31632939-31632961 CCCAGCCCTTCAGGAGGCCCGGG - Intergenic
1172730360 20:37082062-37082084 CCCAGCCTTGCAGGCTCCCCCGG - Intronic
1173539185 20:43838583-43838605 CCCAGCCCTGCAGGTGCTCAGGG + Intergenic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1173873239 20:46354654-46354676 CAGAGCCCTGAAAGTGCACCAGG - Intronic
1174453253 20:50632422-50632444 CCCAGCTCTGCAGGTGAGCCAGG + Intronic
1175465837 20:59191080-59191102 CCTGGCCCTCCAGGGGCCCCAGG + Exonic
1175875462 20:62227431-62227453 CCGATCCCTGCTGGTGCCTGGGG + Intergenic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1176233141 20:64042095-64042117 CTGAGCCCTGCAGGTGTGCAGGG + Intronic
1176717807 21:10368203-10368225 CCGAGCCCTGCAGGTGGCTAGGG - Intergenic
1177229385 21:18299878-18299900 CCAAGCCCTCCAGGTGATCCTGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179893750 21:44350435-44350457 CCGCGCCCTGCAGCAGCACCGGG - Intronic
1179893955 21:44351125-44351147 CCCAGCCCAGCAGATTCCCCGGG - Intronic
1180052225 21:45336364-45336386 CCTACCCCTCCAGGTGCCCTGGG - Intergenic
1180162772 21:46005734-46005756 GCGAGCCCCTCAGGTGCCACAGG + Intergenic
1180299034 22:11021109-11021131 CCGAGCCCTGCAGGTGGCTAGGG - Intergenic
1181009675 22:20032985-20033007 CCAAGCCCTGCAGGTTCCCTAGG - Intronic
1181026735 22:20131507-20131529 CGGAGCCGTGCAGGTGGCCTCGG - Intronic
1181469408 22:23128550-23128572 CCTGGCCCTGCAGGGGCCCTGGG - Intronic
1181543033 22:23584087-23584109 CCCAGCCCCGCAGGGTCCCCAGG - Intergenic
1183035017 22:35134848-35134870 CCGTGCCCTGCTGGTGACCCAGG - Intergenic
1183307336 22:37089684-37089706 TGGGGCCCTGCAGGTGCCACAGG + Exonic
1183580855 22:38725911-38725933 TCGAGCCCTGTTGCTGCCCCTGG + Intronic
1183713629 22:39520983-39521005 CCGAGCCCCGCAAGGGTCCCAGG + Exonic
1183745086 22:39687368-39687390 AGCTGCCCTGCAGGTGCCCCTGG + Exonic
1184086630 22:42269908-42269930 GCGAGCGCGGCCGGTGCCCCCGG + Intronic
1184433897 22:44458504-44458526 CAGAGCCCTGCAGCTGCCCTGGG - Intergenic
1184472671 22:44704534-44704556 TGGAGCCCTGCAGGTGCCGCGGG - Intronic
1184499117 22:44861377-44861399 CCGAGGCCCCCAGGTGCCACTGG - Intronic
1185005997 22:48277310-48277332 CAGAATCCTGCAGGTGCACCTGG + Intergenic
1185068151 22:48642232-48642254 CCCAGCCCTGCCAGAGCCCCAGG + Intronic
1185075623 22:48680576-48680598 CCCAGCACTGCTGCTGCCCCTGG + Intronic
1185143589 22:49117277-49117299 CCGACCCCTGCCCCTGCCCCTGG - Intergenic
1185282047 22:49976268-49976290 GCCTGCCCTGGAGGTGCCCCCGG - Intergenic
950106372 3:10391628-10391650 CCCAGACCTGGAGATGCCCCAGG + Intronic
951491014 3:23270499-23270521 ACGAGCCCTGCAGGGCCCCAGGG - Intronic
953902110 3:46849278-46849300 AAGAGCCCTGCAGGTCTCCCTGG - Intergenic
954381483 3:50221323-50221345 CTGAGCCCTGAGGGAGCCCCAGG + Intergenic
954748318 3:52799499-52799521 CCGAGCCCTGGCTGTGCCACTGG - Intronic
957083514 3:75658614-75658636 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
959873980 3:111360390-111360412 CTGAGCCCTGCAGAGACCCCGGG + Intronic
961336633 3:126184279-126184301 CTGAGCCCTGCCTGTGCCCCAGG + Intronic
961522975 3:127478619-127478641 CCCAGTTCTGCAGGTGCCACCGG - Intergenic
961652182 3:128422139-128422161 CCAGGCTCTGCAGTTGCCCCAGG - Intergenic
961682411 3:128608068-128608090 CCAGGGCCTGCAGGTGCTCCAGG + Intergenic
962316099 3:134360394-134360416 CAGAGACAGGCAGGTGCCCCAGG - Exonic
962530781 3:136277882-136277904 CCTGGCCCTGCAGGTGGCCTGGG - Intronic
962816564 3:139006049-139006071 CTGTGCCCTGCGTGTGCCCCTGG - Exonic
962818063 3:139020442-139020464 CTGTGCCCTGCGTGTGCCCCTGG - Exonic
962820557 3:139044401-139044423 CTGTGCCCTGCGTGTGCCCCTGG - Exonic
963082780 3:141409916-141409938 CCCAGCCCTGCAGGGGCTCTGGG - Intronic
967881910 3:194307500-194307522 CCGGGCCCTGCAGGTGCTTCTGG - Intergenic
968357564 3:198121061-198121083 CCGAGCCCTCCTGGAGCCACTGG - Intergenic
968520485 4:1032743-1032765 CCGGGTCCTCCAGGAGCCCCTGG + Intergenic
968580097 4:1385755-1385777 CCGAGGGCAGCAGTTGCCCCAGG + Intronic
968614019 4:1569276-1569298 CGGTGCCCTGCAGGCTCCCCAGG - Intergenic
968622322 4:1609349-1609371 CCCAGGCCTGCACCTGCCCCGGG + Intergenic
968636578 4:1684125-1684147 CCGCGCCCTCCACGTGCCGCGGG + Intronic
968653345 4:1768510-1768532 CCCAGCCCTGCAGGGGCCTAGGG + Intergenic
968904199 4:3444111-3444133 CCTATCACTGCAGCTGCCCCCGG + Exonic
968947637 4:3673951-3673973 CCCAGCCATGAAGGTGCTCCAGG - Intergenic
969452411 4:7282124-7282146 CCAAGCCATGAAGGTGGCCCGGG - Intronic
969488375 4:7485181-7485203 CCGAAGGCTGCAGGAGCCCCAGG - Intronic
969513145 4:7631229-7631251 CTGAGCCCTGCAGGAGCCAGCGG - Intronic
969611133 4:8228355-8228377 CCGCGCCCTGCGGGTGGCTCGGG + Exonic
971294630 4:25377377-25377399 CAGAGGCCGGCAGGAGCCCCCGG - Intronic
985448027 4:190038302-190038324 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
985451455 4:190065827-190065849 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
985452444 4:190069119-190069141 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
985453429 4:190072416-190072438 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985454419 4:190075709-190075731 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985455407 4:190079002-190079024 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985456392 4:190082296-190082318 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985457379 4:190085596-190085618 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
985458366 4:190088889-190088911 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985459355 4:190092189-190092211 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985463607 4:190174958-190174980 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985530448 5:430962-430984 CCGAGCCCTGCAGAGACCCCAGG - Intronic
985644960 5:1080476-1080498 CCAGGCCCTGCAGCTGACCCTGG + Intronic
985674283 5:1222846-1222868 CTGTGCCCTGCACGTGCCCGGGG + Exonic
985779896 5:1865024-1865046 CACAGCCCTGCAGGTTCTCCAGG - Intergenic
985798654 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG + Intergenic
987248786 5:16078506-16078528 CCCTGCCCTGCTGGTGCCCACGG + Intronic
988928890 5:36016131-36016153 CACAGCCCTGCAGTTGCCCAAGG + Intergenic
989761176 5:45018702-45018724 CCAAGCCCTGCAGATGCCTGGGG + Intergenic
991643470 5:68777158-68777180 CTGTCCCCTGGAGGTGCCCCAGG - Intergenic
992017973 5:72594939-72594961 CTGTGCTCTGCAGGCGCCCCTGG - Intergenic
993110942 5:83656723-83656745 CCAGGCCCTGCAGTTTCCCCTGG - Intronic
993376805 5:87158081-87158103 CCAGGCCCTGCAAGTGCCCAGGG - Intergenic
995732971 5:115265372-115265394 ACGAGCTCTGCAGCTGGCCCCGG + Intergenic
996937534 5:128965764-128965786 CCGTGCCCTGCGAGTTCCCCAGG - Exonic
997518289 5:134506174-134506196 CTCAGCCCCACAGGTGCCCCTGG - Intergenic
998817582 5:146029544-146029566 CCGAGCCCAGCATGGCCCCCAGG - Intronic
1001307478 5:170585891-170585913 CCAAGCCCTGCAGGAGCCAGTGG + Intronic
1001332415 5:170771742-170771764 CCGAGCTCTGCGTGTGACCCCGG - Intronic
1001519115 5:172378181-172378203 CCAAGCACAGCAGCTGCCCCTGG + Intronic
1002122618 5:177017112-177017134 CCAAGCCCAGCAGGGGCCCAGGG - Intronic
1002188444 5:177466873-177466895 CGGAGCGCTCCAGGGGCCCCCGG - Intronic
1002373412 5:178772189-178772211 CCCAGCCCTGCAGGTCCGACTGG - Intergenic
1002426835 5:179181518-179181540 CCCAGCCCTGCCTGTGCCGCGGG - Intronic
1002450893 5:179317927-179317949 CCCAGCCCTGGATGAGCCCCAGG - Intronic
1002452373 5:179326237-179326259 CCCAGCCGGGCAGCTGCCCCAGG + Intronic
1003095431 6:3139533-3139555 CCCCGCCCTGCACGGGCCCCAGG - Intronic
1004169828 6:13287324-13287346 CAGGGCCCTGCTGGTGCCCTTGG - Exonic
1005040179 6:21594451-21594473 CCGGGCCCTCCCGGTTCCCCGGG - Exonic
1005567293 6:27109194-27109216 CAGAGCCCTTCAGGTGCACTTGG + Intergenic
1005989371 6:30893486-30893508 CTGTGCCCTGCAGGTCCCACTGG - Intronic
1006585272 6:35106451-35106473 CCAAGCCCTGCAGGTGCATAAGG + Intergenic
1006627638 6:35408682-35408704 CAGAGGCATGCAGGTGCCCAAGG + Intronic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1007557903 6:42782435-42782457 CCCAGCGCTGCCGGGGCCCCGGG + Intronic
1007752140 6:44077063-44077085 AGGAGCCCTGCCTGTGCCCCAGG + Intergenic
1008131098 6:47720716-47720738 CAGAGCCTTCCTGGTGCCCCTGG - Intronic
1015366390 6:132401581-132401603 GCGCGCCCTGCAGGCGGCCCGGG - Intergenic
1018432171 6:163730939-163730961 CCGAGTCCTGTAGGTGACCTTGG + Intergenic
1019230059 6:170553019-170553041 CTGAGGCCTGCAGGAGCCCGGGG + Intronic
1019455335 7:1123848-1123870 CCGACCCCTGCTGGTGAACCGGG + Intronic
1019743861 7:2688708-2688730 CGGCGCCCTGGAGGTTCCCCGGG - Intronic
1020057562 7:5128431-5128453 CCGGTCCCTGCTGCTGCCCCTGG - Intergenic
1020169964 7:5837551-5837573 CCGGTCCCTGCTGCTGCCCCCGG + Intergenic
1022298930 7:29084208-29084230 CCGGGCCCTGCAGGATCCACTGG + Intronic
1023418013 7:39950311-39950333 CCGAGTCCTCCAAGTGCCCCCGG - Exonic
1023986973 7:45102431-45102453 GCCAGCCCTGCAGGTGGACCTGG - Exonic
1024075468 7:45815738-45815760 CCTAGCCCTGCAGCTGTGCCGGG - Intergenic
1024291450 7:47807476-47807498 CCCAGCCCTGGGGGTGGCCCTGG + Intronic
1025051986 7:55740068-55740090 CCTAGCCCTGCAGCTGTGCCGGG + Intergenic
1025128943 7:56365736-56365758 CCTAGCCCTGCAGCTGTGCCGGG + Intergenic
1025177327 7:56808624-56808646 CCTAGCCCTGCAGCTGTGCCGGG + Intergenic
1026898047 7:74021917-74021939 CCAGGCCCAGCAGGAGCCCCTGG + Intergenic
1026905998 7:74063164-74063186 CCGAGCCCTCCAAGGACCCCAGG - Exonic
1029449284 7:100631936-100631958 CCTTTCCCTGCAGGTGCACCTGG - Exonic
1029478998 7:100801859-100801881 CCTGCCCCTGCAGGTGCCCGGGG + Intergenic
1033144492 7:138859681-138859703 CTGAGTCCTCCAGTTGCCCCAGG - Intronic
1034338973 7:150340507-150340529 CCGGGGCCTGCAGGTGGCCCTGG - Exonic
1034349784 7:150408275-150408297 CCGACCCCTGGAGATGGCCCTGG + Intronic
1035037375 7:155904027-155904049 CCGAGGCCTGCAGGGACACCAGG + Intergenic
1035203155 7:157279418-157279440 CCGAGGCCTGCAGGAGACCCGGG + Intergenic
1035231328 7:157467768-157467790 CCCAGCCTTGGAGGTCCCCCGGG - Intergenic
1035344754 7:158190764-158190786 CAGAGCCATGCAGGGGCCACGGG - Intronic
1035460130 7:159033403-159033425 CCCAGCCCAGAAGGTGCCTCGGG - Intronic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1035737435 8:1898707-1898729 CTGGGCCCTACAGCTGCCCCCGG - Intronic
1036648298 8:10625698-10625720 CTGAACCATCCAGGTGCCCCCGG + Intronic
1037811734 8:22090409-22090431 CCCAGCCCTGCTGTTGACCCAGG + Intronic
1037829850 8:22180971-22180993 AAGAGCCCTTCAGGAGCCCCTGG - Intronic
1038455428 8:27669493-27669515 CCTTGGCCTGCAGGAGCCCCTGG - Intronic
1038496515 8:28007144-28007166 CTGAGCCCTGCAGGCTTCCCAGG + Intergenic
1039555689 8:38473160-38473182 CAGCCCCCTGCAGATGCCCCCGG - Intergenic
1039790513 8:40872317-40872339 CCCAGCCCTCCAGGTGCCAGCGG + Intronic
1041306868 8:56470754-56470776 CTGAGACCTGGAGGGGCCCCAGG + Intergenic
1041687841 8:60660663-60660685 CAGAGCCCTCCAGCTGCCCGGGG - Intergenic
1046519416 8:115305041-115305063 TCCAGCCCAGCATGTGCCCCTGG - Intergenic
1048963870 8:139601080-139601102 CCGGGCCCTGCAGGAGGGCCAGG + Intronic
1048977668 8:139681990-139682012 CCAGGCCCTGCAGGTACCCTGGG + Intronic
1049221585 8:141431125-141431147 CCCAGCCCAGCAGGGGCTCCAGG + Exonic
1049224824 8:141445161-141445183 TGGAGCCCTGGAGGTGGCCCCGG - Intergenic
1049372642 8:142275062-142275084 CGGAGGCCTGGAGGTGGCCCAGG + Intronic
1049755994 8:144311568-144311590 CCGAGCCGTGGACGTGCTCCAGG - Exonic
1049773035 8:144392488-144392510 GCGAGCCCCACAGCTGCCCCAGG - Exonic
1053288753 9:36866374-36866396 CTGAGACCTGCAGGTACGCCGGG - Intronic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1056058949 9:82862426-82862448 ACAAGCCCTGCAGGTGCTGCTGG + Intergenic
1057194923 9:93111548-93111570 CCCAGCCCTGCAGGTGGGACTGG + Intronic
1057401505 9:94727072-94727094 CCGAGACCGGCAGGTGACCGAGG - Intronic
1057700447 9:97360155-97360177 CTGAGCCCTGCAGGTCTCCTGGG - Intronic
1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG + Intronic
1059357977 9:113715968-113715990 TGGATCCATGCAGGTGCCCCTGG - Intergenic
1059745219 9:117193793-117193815 CCTTGCCCTGCACGTGCTCCTGG + Intronic
1060220623 9:121762353-121762375 GGGAGCCCTGGAGGAGCCCCGGG + Intronic
1060246445 9:121950549-121950571 CTGAGGCCAGCAGGTGCCACAGG + Intronic
1060406021 9:123373507-123373529 CCGGGCCCTGCAGGAAGCCCAGG - Exonic
1060439477 9:123625827-123625849 CCAATCCCTGCAGAAGCCCCGGG + Intronic
1060849283 9:126860938-126860960 CTGACCCCAGCAGGTGCCCGGGG - Intronic
1060992277 9:127856036-127856058 CCAGGCCCTCCAGGTGGCCCAGG - Intergenic
1060999703 9:127896288-127896310 CGGCGTCCTGCAGGTGGCCCTGG + Exonic
1061062556 9:128257991-128258013 CCGGGCCCTGCAGGGGGCCATGG - Exonic
1061062590 9:128258084-128258106 CCGAGGCCAGCAGGTGAGCCAGG + Exonic
1061257514 9:129461019-129461041 CCCTGCCCTCCAGGAGCCCCTGG + Intergenic
1061403663 9:130382188-130382210 CCGGGTCCTGCAGATCCCCCTGG + Intronic
1061701936 9:132422687-132422709 TTGACCCCTGCAGGTGTCCCTGG - Intronic
1061866110 9:133492520-133492542 CCCAGGGCTGCAGGTGGCCCAGG + Intergenic
1061942891 9:133892546-133892568 CCGAGCCCTGCATGGGGCCCAGG - Intronic
1062206779 9:135341868-135341890 GCCTGCCCTGCAGGTGCACCCGG - Intergenic
1062336791 9:136074790-136074812 CCGAGCCCCGCAGGTGAGCTGGG - Intronic
1062606750 9:137351937-137351959 ATGAGCCCGCCAGGTGCCCCAGG - Intronic
1062722547 9:138051929-138051951 CCTTGCCCTGCAGGTGCCACAGG - Intronic
1203441768 Un_GL000219v1:16008-16030 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1203512578 Un_KI270741v1:134917-134939 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1185542671 X:915995-916017 CTGAGCCCTGCAGGTGGCTAGGG + Intergenic
1186349978 X:8731367-8731389 CCCAGCCCCGCAGGTGCCCGCGG - Intronic
1187031506 X:15493160-15493182 TGGACCCCTGCAGGAGCCCCAGG + Exonic
1188511229 X:30938471-30938493 CCAAGCCCTGTAGGTCCGCCTGG - Intronic
1189262657 X:39689247-39689269 CCAAGGCCTGCGGCTGCCCCCGG + Intergenic
1190877376 X:54469746-54469768 TAGAGCCCTGCAGGGGCCCGAGG - Intronic
1191937038 X:66437415-66437437 CCAAGGCCTGCAGGTGCTCTGGG - Intergenic
1192431954 X:71118714-71118736 CCTGGCCCTGCTGGTGCCTCCGG + Exonic
1192451368 X:71247175-71247197 CCGAACCCTGCAGGTACCGGGGG - Intronic
1197874298 X:131087418-131087440 CCAAGCCCTGAAGAAGCCCCTGG + Intronic
1199979489 X:152913161-152913183 CCTAGCCCTGGAGGGGCCCAGGG + Intergenic