ID: 1035688894

View in Genome Browser
Species Human (GRCh38)
Location 8:1547149-1547171
Sequence CACAGGGACGTGCGGACCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035688889_1035688894 4 Left 1035688889 8:1547122-1547144 CCGGGTGTGCTTAAGGCTCAGCA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1035688894 8:1547149-1547171 CACAGGGACGTGCGGACCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035688894 Original CRISPR CACAGGGACGTGCGGACCGT GGG Intronic
No off target data available for this crispr