ID: 1035689716

View in Genome Browser
Species Human (GRCh38)
Location 8:1552088-1552110
Sequence GTGGCTGGCTGCAGAACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035689716_1035689723 11 Left 1035689716 8:1552088-1552110 CCTGTTGTTCTGCAGCCAGCCAC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1035689723 8:1552122-1552144 CTTCCCTGCCCTGACGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035689716 Original CRISPR GTGGCTGGCTGCAGAACAAC AGG (reversed) Intronic
900103694 1:973400-973422 CTGGGTGGCTCCAGGACAACTGG - Intronic
901147520 1:7076151-7076173 GTTGCTGGCTGCAGATCTGCTGG + Intronic
901768710 1:11519760-11519782 GAGGCTGGCTGCAGACCCTCGGG - Exonic
901954430 1:12773845-12773867 CTGGCTGGCTGCAGATCAGATGG - Intergenic
901972157 1:12916716-12916738 CTGGCTGGCTGCAGATCAGATGG - Intronic
902013021 1:13285046-13285068 CTGGCTGGCTGCAGATCAGATGG + Intronic
903658415 1:24962779-24962801 GTGGCTGGCAGTAGCACAAAGGG - Intronic
903935301 1:26891025-26891047 GGGGCTGTCTGAAGCACAACTGG + Exonic
904578588 1:31522996-31523018 GAGGCTGCCTGCAGAACAGAGGG + Intergenic
907993230 1:59603415-59603437 GTGACTGGCTGAACAACCACAGG - Intronic
908429871 1:64046088-64046110 ATGGGCAGCTGCAGAACAACTGG - Intronic
910338038 1:86155800-86155822 GGGGGTGGCTGCAGAACCTCGGG - Intronic
914880372 1:151541746-151541768 GTGGCAGGCTACAGAAGAATGGG - Intronic
919818508 1:201457342-201457364 CTGGCTGGCTGCAGAATCTCAGG + Intergenic
922087512 1:222364968-222364990 GTGGATGTTTGCAGAACATCTGG - Intergenic
922533529 1:226362988-226363010 GTGGCTGGCTGTCAAACAGCTGG - Intronic
923095320 1:230770813-230770835 GTGGGTGGCTACAGAAGACCAGG - Intronic
923765922 1:236892350-236892372 GTAGCTGGCTGAAGAAGTACAGG - Intronic
1063188336 10:3670160-3670182 GTGGCTGGATCCAGAAGAGCAGG - Intergenic
1065739569 10:28784727-28784749 GGGGCTGGCTGCAGAGAAGCTGG - Intergenic
1066567088 10:36732337-36732359 GTGGCAGGTTGCAGATCAATGGG + Intergenic
1069900088 10:71702060-71702082 GTGGCTGGATGCTGTACACCAGG - Intronic
1070159827 10:73859588-73859610 GTTCCTGGCCGCAGAACTACTGG - Intronic
1078187031 11:9060805-9060827 GTTGCTGGCTGCAGATCAGCAGG - Intronic
1078337855 11:10477872-10477894 ATGGCTGGCAGCAGACCTACTGG - Intronic
1079111935 11:17610011-17610033 GTGGGTGTCTGCAGTGCAACAGG - Exonic
1080811833 11:35712106-35712128 TTGCCTGGCTGCAGAGTAACTGG + Intronic
1083632618 11:64103651-64103673 GTGGCGGGCTGCAGACAAAAGGG + Exonic
1088700455 11:112406917-112406939 GTGGCTGGCAGTGGAACAGCAGG + Intergenic
1089046003 11:115503152-115503174 GAGGCTGGGTGCAGCACAGCCGG + Intronic
1093075772 12:14757186-14757208 GTGGCTGGATGTACAATAACTGG + Intergenic
1094374561 12:29776214-29776236 GTGGCAGGTTGCAGCACAAATGG - Intronic
1094673219 12:32591664-32591686 ATGGCTGGAGGCAGAACAAAGGG - Intronic
1096684181 12:53276998-53277020 AGGGCTAGCTGCAGAACAGCTGG - Intronic
1097197651 12:57252498-57252520 CTGACAGGCTGCAGAACAACAGG + Intronic
1100270188 12:93017131-93017153 GAGGCTGGCTGGAGAACAAAGGG + Intergenic
1101173257 12:102121230-102121252 GGAGCTGGCTGCACAAAAACAGG - Intronic
1104944576 12:132409887-132409909 GTGGGTGACGGCAGAACATCTGG + Intergenic
1105073571 12:133253726-133253748 GTGGGAGGCTGCAAAGCAACTGG - Intergenic
1106777338 13:33020901-33020923 TTAGCTGGCTCCAGAAGAACAGG - Intronic
1108466844 13:50725224-50725246 GTGGCTGGCTGGAGAAGATTGGG - Intronic
1109366335 13:61361393-61361415 GTAGCTGGCTGCTCAGCAACAGG + Intergenic
1110008055 13:70297131-70297153 GTGGGTGACTGCAGAAGCACAGG - Intergenic
1111206708 13:85020395-85020417 GAGCCTGGCTGCTGAGCAACCGG + Intergenic
1111253349 13:85635014-85635036 GTGGCTGACTGCAAACCAAGAGG - Intergenic
1114683409 14:24506170-24506192 GTGGCTGGCTGGGGAAGAACAGG - Exonic
1114788127 14:25624654-25624676 CTGGCTGACTTCAGAGCAACTGG + Intergenic
1115767470 14:36638221-36638243 GTGACAGCCTGCAGGACAACTGG + Intergenic
1116545360 14:46158862-46158884 CTGGCTTGCTGGAGAACAAAAGG + Intergenic
1121641930 14:95490634-95490656 GAGGCTGGCTGCAGAGCCAAAGG + Intergenic
1122671976 14:103379525-103379547 GAGGATGGCTGCATAACAGCAGG + Intergenic
1124641616 15:31399648-31399670 GTGGCTGGGTGCGGGACAAGGGG + Intronic
1127295793 15:57607710-57607732 GTGACTCACTGCAGAAGAACTGG + Intronic
1127885421 15:63195426-63195448 CTTGCTGCCTGCAGAACAGCTGG - Intronic
1131808067 15:96143725-96143747 GTTCCTGGCTGCAGACCAAAAGG - Intergenic
1137273238 16:46916773-46916795 CTCTCTGGCTGCAGAACAATGGG - Intronic
1139295491 16:65896983-65897005 ATCCCTGGCTGCAGAACAAGTGG + Intergenic
1142891606 17:2947637-2947659 CAGGCTGGCTGCAGAACAGAAGG - Intronic
1144772660 17:17768673-17768695 GTGTCTGGCTGCAGGTCAGCAGG - Intronic
1146182439 17:30706830-30706852 GTGGTTGACTGCAGACCCACTGG - Intergenic
1146848578 17:36201884-36201906 GGGGCTGGCTGCAGAAAGAAGGG - Intronic
1149970243 17:61210802-61210824 TTGTCTGTCTGCAGCACAACTGG - Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150461512 17:65357543-65357565 GTGGCTGAATGCAGAAGCACAGG + Intergenic
1151758771 17:76089139-76089161 GGGGCTGGCTGCAGAGCCCCCGG + Intronic
1152127668 17:78456990-78457012 GCAGCTGCCTGCTGAACAACAGG - Intronic
1152574641 17:81134676-81134698 GTGGCTGGCTGCAGGACTGCAGG - Intronic
1156159460 18:34342314-34342336 GTGGCTGAGTGCAGAGCAAAAGG + Intergenic
1156370080 18:36465385-36465407 GTGGCTGCCTCCAGAACCATGGG + Intronic
1156454677 18:37286349-37286371 GTCGCTGCCTGCAGACCACCTGG + Intronic
1156988134 18:43373635-43373657 GTTGCTTGTTGGAGAACAACTGG - Intergenic
1158151045 18:54370854-54370876 GTGGCTGGATGCAGATCATTTGG + Intronic
1159686756 18:71431346-71431368 CTGGCAGGATGGAGAACAACTGG - Intergenic
1161456038 19:4370177-4370199 GGGGCTGGCTGCCCCACAACAGG - Intronic
1161556424 19:4945185-4945207 GTGGCAGGCTGCACCTCAACCGG + Intronic
1161750133 19:6089734-6089756 CTGGCTGGCTTCTAAACAACAGG - Intronic
1162976382 19:14208971-14208993 GTGGTTGACTGCAGATCCACTGG + Intergenic
1163129463 19:15263604-15263626 GTGGCTGGCAGCAGACGAAAGGG + Intronic
1163718008 19:18883676-18883698 GTGGTTGGCTCTAGAACATCAGG + Intronic
1164634088 19:29780092-29780114 GCTGCTGGGTGGAGAACAACAGG - Intergenic
1165774154 19:38395183-38395205 GTGGCTGGGTCCAGAACCCCTGG + Intronic
1166612131 19:44207814-44207836 GAGGCTGGCTGCGGAACGCCAGG - Intronic
927368351 2:22325779-22325801 AGGACTGGCTGCAGAACAAATGG + Intergenic
928072811 2:28234331-28234353 GGGCCTGGCAGCAGAACACCTGG + Intronic
928897690 2:36283658-36283680 ATGGCTTGCTGCAGATCAAGGGG + Intergenic
930784022 2:55252951-55252973 GTGGCTGCCTGTACAACAATTGG - Intronic
932620901 2:73264512-73264534 GGGGCGGGCTGCAGAATACCAGG + Exonic
934084794 2:88501091-88501113 GTTGCTGGCTGCTGAAGAGCAGG - Intergenic
935046858 2:99490217-99490239 GCGGGCGGCTGCAGAACAACAGG - Intergenic
935950086 2:108320729-108320751 GTGAGTGGCTGCTGAACAATGGG - Intergenic
936055521 2:109259267-109259289 GCTGCTGGCTCCTGAACAACTGG + Intronic
937354113 2:121187401-121187423 GTGGCTGGAATCAGAACACCTGG + Intergenic
937356645 2:121202055-121202077 GGGACTGGCTGCAGATCTACAGG - Intergenic
938747698 2:134295650-134295672 GTTGCTGGCTGCAGCCAAACAGG + Intronic
944865797 2:203860292-203860314 GTGGCTGGCTGTGTTACAACAGG + Intergenic
945027261 2:205631045-205631067 GTGGGTGGCTGCAGGAGCACTGG + Intergenic
945040371 2:205738882-205738904 GTGGCTGGCTGAAGACAAACAGG - Intronic
947996780 2:234534683-234534705 GAGGCTGGCCGCAGAGCAGCAGG - Intergenic
948176205 2:235945441-235945463 GTGCATGGCTGGAGAACAGCAGG + Intronic
1172122969 20:32609411-32609433 GGGGCCGGCTGGGGAACAACTGG + Intergenic
1173599494 20:44283250-44283272 GTGGATGGTTGCAGCACTACAGG - Intergenic
1174376343 20:50128990-50129012 GAGGCTGCCTGAAGAACAAATGG + Intronic
1174598753 20:51707035-51707057 GTGGCAGGCTACAGAACCCCAGG - Intronic
1174967018 20:55227509-55227531 GTGGCAGGTAGCAGAACAGCTGG - Intergenic
1175136631 20:56829208-56829230 GTGGCTGGATGCAGAAAAGGGGG - Intergenic
1175401790 20:58704200-58704222 GTGGCTGCCTGTAGAGCAAATGG + Intronic
1175494681 20:59405352-59405374 CTGGCTGAGTGCAGAACAGCAGG + Intergenic
1175784871 20:61706108-61706130 GAGGCTGGCTGAGGAACAGCCGG + Intronic
1175862371 20:62157197-62157219 GTGGGTGGCAGCAGAGGAACAGG - Intronic
1176412361 21:6455912-6455934 TTGGCTGGATGCAGAAAGACAGG + Intergenic
1179687855 21:43064234-43064256 TTGGCTGGATGCAGAAAGACAGG + Intronic
1180228702 21:46413389-46413411 GAGGCTGGGTGCAGAACATGTGG + Intronic
953572235 3:44080135-44080157 GTGGCTGGCTGGTGAGCTACTGG - Intergenic
954712517 3:52512215-52512237 CTGGGTGGCTGCAGAGCAAGGGG + Intronic
958574912 3:95936190-95936212 TTGTGTGGTTGCAGAACAACTGG - Intergenic
959100112 3:102000711-102000733 GTGGATGGCTACAGTACAACAGG - Intergenic
960463668 3:117968641-117968663 GTGGCTTGCTTCAGAAAATCTGG + Intergenic
961165476 3:124760551-124760573 GTGGCTGCCTGCAAGCCAACAGG - Intergenic
961681832 3:128604558-128604580 CTGCCTGGCTGCAGAAACACAGG - Intergenic
962107054 3:132401359-132401381 GTTTCTGGCTGCACAACGACCGG + Intergenic
967813037 3:193776272-193776294 GTGCCTGGATACAAAACAACAGG - Intergenic
979078895 4:116309871-116309893 GTAGCTGCATGCAGAAAAACAGG + Intergenic
979655587 4:123189602-123189624 GTGGCTGTACCCAGAACAACAGG + Intronic
981301108 4:143186046-143186068 GTAACTTGCTGCAGAACATCTGG + Exonic
991682938 5:69156553-69156575 GATGGTGGCTGCACAACAACTGG + Intergenic
995134065 5:108661258-108661280 ATGACTGGCTGCAGGGCAACAGG + Intergenic
997393836 5:133540424-133540446 GTGCCTTGCTGCTGAACAACAGG - Intronic
999115131 5:149156079-149156101 CAGCTTGGCTGCAGAACAACTGG - Intronic
1007005749 6:38360789-38360811 GTGGCTGTGAGGAGAACAACAGG + Intronic
1010521392 6:76842555-76842577 GTGTCTGACTGCACCACAACTGG + Intergenic
1010711899 6:79184813-79184835 GAGTCTGGTTACAGAACAACAGG - Intergenic
1011452043 6:87503476-87503498 GTGGCTGGTCGCAGATCACCAGG + Intronic
1015308514 6:131737340-131737362 ATTGCTGGCTGCAAAACAAATGG - Exonic
1017927555 6:158923423-158923445 GGGGCAGGGTGTAGAACAACTGG - Intergenic
1020777495 7:12473197-12473219 GTGCCTGGATGCAGGACAGCAGG - Intergenic
1022103300 7:27181893-27181915 GTGTCTGGCTGCAGAGCAGTGGG - Exonic
1023104209 7:36747460-36747482 GGGGGTGGCTGCAGAACCACAGG + Intergenic
1023807527 7:43884232-43884254 GCTGATGGCTGCAGAACATCAGG - Intronic
1024559202 7:50629310-50629332 GGGGATGGCTGTGGAACAACAGG - Intronic
1026051494 7:66950937-66950959 GTGGCTGTCTGCAGGAGAAGAGG - Exonic
1026183709 7:68064295-68064317 CTGGCTGGCTTCAGATCAACTGG + Intergenic
1026348770 7:69497643-69497665 GTGACTGTGTGCAGAAAAACAGG + Intergenic
1030900798 7:115120879-115120901 ATGGCTGGCTGCAGGACCCCTGG - Intergenic
1031244814 7:119297979-119298001 CTGGATGGCAGCAGAATAACTGG - Intergenic
1031596490 7:123655864-123655886 GTGGCAGGCTGGTCAACAACTGG - Exonic
1035594758 8:848055-848077 GTGGCTGGGAGCAGGGCAACAGG - Intergenic
1035689716 8:1552088-1552110 GTGGCTGGCTGCAGAACAACAGG - Intronic
1035899232 8:3439879-3439901 GTGAATGGCTCCAGGACAACTGG - Intronic
1038436046 8:27536865-27536887 GGGGATGGGTGCAGAAGAACAGG + Intronic
1038484031 8:27921197-27921219 GAGGCTGGGGGCAGAACAACTGG - Intronic
1039589912 8:38737572-38737594 GTCCCTGGCTGGAGAACACCAGG + Intronic
1039828554 8:41195046-41195068 GGGGCTGGCTGCAGAGCTGCGGG - Intergenic
1042711317 8:71720508-71720530 GTGGGTTGCTGGAGAACAAAGGG - Intergenic
1042906167 8:73774224-73774246 GGGACTGGCTTCAGAACAGCTGG - Intronic
1047379810 8:124349443-124349465 CTGGATGGTTTCAGAACAACTGG + Intronic
1047616294 8:126565191-126565213 GTGGCTTTCTGCAGGACAAATGG + Intergenic
1047757103 8:127927106-127927128 GTGCCTGGCTCCTGAGCAACAGG - Intergenic
1048195772 8:132330696-132330718 GTTTCTGGCTGCAGAAAATCAGG - Intronic
1049337717 8:142095472-142095494 GTGCCTAGCTGGAAAACAACAGG + Intergenic
1052768248 9:32663408-32663430 GTAGCTGGCTGGAGAATAAGGGG + Intergenic
1059403057 9:114082457-114082479 GTGGCTTGCTGCGGGACAATGGG + Intergenic
1061588617 9:131584056-131584078 CTGGGTGGCAGCAGAACACCGGG + Intronic
1062175239 9:135158368-135158390 TTGGCAGGCTGGAGAACCACAGG + Intergenic
1062503197 9:136859976-136859998 GGCGCTGGCTGCAGAAGAAGGGG + Exonic
1062673936 9:137728920-137728942 GTGGCTGGTGGCAGAGCAGCTGG - Intronic
1187910092 X:24103797-24103819 GTGGCTGGATGTTGAACCACTGG - Intergenic
1189571438 X:42302052-42302074 GTTGATGGCTGGAAAACAACTGG - Intergenic
1195825535 X:108996125-108996147 GTGACAGGCTGCAGAAGAAAGGG + Intergenic
1200829711 Y:7678791-7678813 GTGGCAGGCTGCAGGACTGCGGG + Intergenic