ID: 1035691778

View in Genome Browser
Species Human (GRCh38)
Location 8:1563909-1563931
Sequence TGTAAAATACTTAGCTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035691778_1035691782 20 Left 1035691778 8:1563909-1563931 CCTCAGTAGCTAAGTATTTTACA 0: 1
1: 0
2: 1
3: 22
4: 197
Right 1035691782 8:1563952-1563974 GTCTGAAGACCTTTTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035691778 Original CRISPR TGTAAAATACTTAGCTACTG AGG (reversed) Intronic
902928565 1:19714421-19714443 TGTAACATACTTAGCGGGTGGGG + Intronic
904283881 1:29441496-29441518 TGTAAAATATTAAGATACTGTGG - Intergenic
906201665 1:43964507-43964529 TGTAGAAGACTGAGCTAGTGAGG - Intronic
910345244 1:86228861-86228883 TGTTAAATACTTCCCTCCTGGGG - Intergenic
911124496 1:94328217-94328239 TTTGAATGACTTAGCTACTGTGG - Intergenic
912196770 1:107406793-107406815 GGTAAAAAACTGAGCTACAGAGG + Intronic
913351161 1:117861194-117861216 TGAAAAATACATTTCTACTGTGG + Intergenic
916234652 1:162574492-162574514 TTTAAAATCCTTAGGTAATGTGG - Intronic
918499441 1:185177633-185177655 AGGAAAATAATTATCTACTGAGG - Intronic
920181271 1:204133339-204133361 TGTAAAATGGTGAGCTACTATGG - Intronic
1064821140 10:19334673-19334695 GGGAAAATACTTTGCTACTCTGG + Intronic
1065056345 10:21846721-21846743 TGTAAAACACTTTGATACTTGGG - Intronic
1071010452 10:80934188-80934210 TGTAAAAGATGTAGCTACTTTGG + Intergenic
1071977109 10:90966080-90966102 TTTAATAGACTTAGCTGCTGTGG + Intergenic
1073804139 10:107078143-107078165 TGTAAAATACTTTGGGACAGTGG + Intronic
1074486444 10:113887645-113887667 TGTAAAAATCCTAGCTACTTGGG + Intronic
1074872947 10:117591598-117591620 TGTAAAATATTACACTACTGGGG + Intergenic
1075576625 10:123582443-123582465 TGACAAATTCTTAGCTGCTGTGG - Intergenic
1080378083 11:31737846-31737868 TGTAAAATGTATAGCCACTGTGG + Intronic
1081128883 11:39351990-39352012 TGTAAAATATGTAGCCACTCTGG - Intergenic
1084803403 11:71562200-71562222 TGTAAATTGCTCAGCCACTGTGG + Intronic
1085701293 11:78748232-78748254 TGTAAAACACTTAGGTATTAGGG - Intronic
1085955729 11:81392103-81392125 TGTTAAATACTGAATTACTGAGG + Intergenic
1086480571 11:87232854-87232876 TGAAAAATACTCAGTTACTGGGG + Intronic
1086784701 11:90953630-90953652 AATAAAATACATAGTTACTGAGG + Intergenic
1087011377 11:93517122-93517144 TGTAGGAAACTCAGCTACTGGGG - Intronic
1087542367 11:99536135-99536157 TTTTAAATACTTAGCTTCTGAGG - Intronic
1087873397 11:103326637-103326659 TGGAAAATACTCAGATAGTGCGG + Intronic
1088099939 11:106143925-106143947 TGAAAAATAATGAGCTGCTGGGG - Intergenic
1088152310 11:106759504-106759526 TGTTAAATTCTGAGATACTGAGG - Intronic
1088537750 11:110879764-110879786 TGGATAATACTTAGCCAATGGGG - Intergenic
1090046599 11:123340849-123340871 TTTAAAATATTTACCCACTGGGG + Intergenic
1090626031 11:128609590-128609612 AATAAAATAATTACCTACTGTGG - Intergenic
1090753523 11:129768095-129768117 TGTAAAATACTTGACCAATGAGG + Intergenic
1096305611 12:50472663-50472685 AGTAAAATATTTAGCTAGGGTGG - Intronic
1097322200 12:58238304-58238326 TGTAAAATAATTAGCTTTAGTGG - Intergenic
1097909507 12:64954494-64954516 TTTAAATTACTTAGTTTCTGTGG + Intergenic
1097941294 12:65309314-65309336 AGTAAAATATTTAGCCATTGTGG - Intronic
1098405449 12:70121431-70121453 TGTGAAATACTTAGCATCTCTGG - Intergenic
1098644100 12:72877157-72877179 TGGAAAATACTTAGAGACTAAGG - Intergenic
1099741410 12:86640199-86640221 TGTAAAATACTTATATATGGTGG - Intronic
1100026080 12:90129825-90129847 TGTAAATAACTTAGCTCCTTTGG + Intergenic
1100027690 12:90150126-90150148 TGGAAAATTATTAGGTACTGAGG + Intergenic
1104276889 12:127337193-127337215 TGTAAACCTCTTAGCTGCTGCGG + Intergenic
1106229162 13:27808461-27808483 AGTCACATACTTAGGTACTGGGG - Intergenic
1106380417 13:29232450-29232472 TGTAAAATAAATAGCCATTGGGG + Intronic
1108788106 13:53931686-53931708 TGCTAAATACTATGCTACTGTGG + Intergenic
1110466717 13:75810283-75810305 GGGAAGATACTTAGCTACTGAGG - Intronic
1114877222 14:26735465-26735487 TGTAAATTAATTAACCACTGTGG + Intergenic
1114911041 14:27197220-27197242 TGCAAAATAATTTTCTACTGTGG - Intergenic
1114971085 14:28029527-28029549 AGTAAAATTCTTAGATACTATGG - Intergenic
1116274697 14:42817475-42817497 AGTAAAATACTTATACACTGTGG + Intergenic
1116784218 14:49269536-49269558 TGTAAAATCCTTAGATACAATGG - Intergenic
1117034929 14:51718416-51718438 TCTAAAATAATTAGGAACTGTGG - Intronic
1117660700 14:58001489-58001511 TGTAAAATGGATAGCCACTGTGG - Exonic
1119927040 14:78504553-78504575 TGAAAAATACATAGTTCCTGAGG - Intronic
1120093826 14:80365279-80365301 AGTTAAATTCTTAGGTACTGGGG + Intronic
1120304739 14:82754765-82754787 TGCAAACTACTTAGCTGATGGGG + Intergenic
1120421656 14:84293828-84293850 TGTAAAGTAGTTATCTCCTGGGG + Intergenic
1120943771 14:89974649-89974671 TGTAAAATGCTGAGCAACGGGGG - Intronic
1124001041 15:25760090-25760112 TTTAAATTACATAGCTACTCAGG - Intronic
1125078122 15:35644317-35644339 AGTAAAGTACTTACCTACTTTGG + Intergenic
1126560079 15:50034147-50034169 TGTAAATTACTTAGTCACTGTGG - Intronic
1126938212 15:53735682-53735704 TGTAAGATTATTTGCTACTGGGG - Intronic
1127577613 15:60307225-60307247 TGTAAAGTACATAGCTACAGTGG - Intergenic
1128585365 15:68844617-68844639 TGTAAAATATGCAGCCACTGTGG + Intronic
1129576463 15:76753026-76753048 TGTAAAATATTTAACTAGTATGG + Intronic
1130741222 15:86602591-86602613 TGAAAAATACCCAGCTAGTGAGG + Intronic
1132562699 16:605098-605120 TGTAATAGTCTTAGCTACTCAGG + Intronic
1133624177 16:7554863-7554885 TTGAAAATACTTAGCTATTAGGG + Intronic
1137284982 16:47008209-47008231 TGTAATATTCCCAGCTACTGGGG + Intergenic
1138871428 16:60892567-60892589 TGGAAAATAATTTGCAACTGTGG - Intergenic
1143930355 17:10416537-10416559 TGTAAAATGATCAGCCACTGTGG - Intronic
1148058818 17:44820114-44820136 TGTAAAAAAATTAGCCACTGTGG - Intronic
1149368819 17:55972216-55972238 TGAAAAATACCTGGCTACTAAGG - Intergenic
1150092421 17:62339454-62339476 TGTATAATCCTGAGCTGCTGGGG - Intergenic
1151207586 17:72519283-72519305 TGTGAAACCCTTAGCTGCTGAGG - Intergenic
1151625903 17:75275566-75275588 TGTAAAAATCTGAGCAACTGAGG + Intronic
1155190571 18:23425851-23425873 TATAAATTAGTTAACTACTGGGG + Intronic
1155190588 18:23426030-23426052 TATAAATTAGTTAACTACTGGGG + Intronic
1155905247 18:31442905-31442927 TGTTAAAAATTTAGCTAATGAGG + Intergenic
1156474239 18:37395561-37395583 TGTAAAACACTAAGCCCCTGAGG + Intronic
1157401058 18:47388358-47388380 TGTAAAATTCTTAGATATTCTGG + Intergenic
1158345078 18:56508126-56508148 GGAAAAATACTTACCTCCTGGGG - Intergenic
1162596222 19:11631426-11631448 TGTAAAATACTAAGCCACTGTGG + Intergenic
926505161 2:13705120-13705142 TGAAAAATATTCAGCTACTCGGG - Intergenic
927586756 2:24314613-24314635 TGTAAAGCACTAAGCTACTTTGG + Intronic
929373104 2:41250609-41250631 AGTAAAATTCATAGCTTCTGGGG + Intergenic
930135754 2:47903516-47903538 TTCAAAATTATTAGCTACTGAGG - Intronic
931410921 2:62030375-62030397 AGAAAAAAACTTAGCTTCTGCGG + Intronic
932976986 2:76614749-76614771 TTTAAAATGCTGTGCTACTGGGG - Intergenic
933424407 2:82091429-82091451 TTTAATATACTTTGCTATTGCGG - Intergenic
934541574 2:95179754-95179776 TCTAAAAGACTTAGATGCTGTGG + Intronic
934888542 2:98046108-98046130 GGTAAAATTCTGAGATACTGGGG + Intergenic
938738387 2:134207314-134207336 TGTAACATACTCAGATTCTGGGG + Intronic
939015143 2:136894052-136894074 TGTAAAATAAAAAGCTATTGTGG + Intronic
939718125 2:145611223-145611245 TGTAAATTACTTTGCTGCTGGGG + Intergenic
940778994 2:157913636-157913658 TATAAATTAGTTAGCCACTGTGG + Intronic
941142104 2:161796649-161796671 TGAAAAATACATAGATAATGTGG - Intronic
944340551 2:198592102-198592124 TGTAATGTACTCAGCTACTCAGG + Intergenic
947272288 2:228350076-228350098 TTTAAAATACTTAAATAATGTGG + Intergenic
1172726578 20:37048191-37048213 TCTAAAATACATAGCAACTGAGG + Intronic
1173537909 20:43829901-43829923 TGGAAAAGCTTTAGCTACTGAGG - Intergenic
1174249978 20:49211912-49211934 TGTAAAATGGTTAGCTGGTGTGG - Intergenic
1174500872 20:50983045-50983067 TGTAAAATGCGTGGCTGCTGTGG + Intergenic
1175453462 20:59091026-59091048 TCTAAAATAATTAACTACTGTGG + Intergenic
1177831782 21:26147366-26147388 TAAAAAATATTTAGCTACTGTGG + Intronic
1178140285 21:29675128-29675150 TGTAAGTTACTTAACTACTCTGG - Intronic
1179123037 21:38566453-38566475 TCTAAAACACTCAACTACTGGGG + Intronic
949432478 3:3992614-3992636 TGTAAAATGGTGACCTACTGAGG - Intronic
949776910 3:7643772-7643794 TGTAAAACACTTAGGCACTGTGG - Intronic
950988239 3:17400443-17400465 TGGCAAATACTTAGCTTGTGAGG - Intronic
951357394 3:21684563-21684585 TTTATAATACTTAACTATTGAGG - Intronic
953934835 3:47032357-47032379 TGTACAAAACTTAGCTACTTGGG + Intronic
955863529 3:63357444-63357466 TGTGACGTCCTTAGCTACTGAGG - Intronic
957985217 3:87565892-87565914 TATAAAATACAGAGCTTCTGAGG + Intergenic
958055540 3:88405949-88405971 TGAAAAAAACTTAGGTTCTGAGG - Intergenic
960519855 3:118642066-118642088 AGGAAAATACTGAACTACTGAGG + Intergenic
962031897 3:131609725-131609747 TTGAAAATTCTTAGCTAATGTGG - Intronic
962230618 3:133662216-133662238 TGTAAAATAAATATCTATTGAGG - Intergenic
962505034 3:136038233-136038255 TGTATAACACTTGGCTACTCAGG + Intronic
963872511 3:150433396-150433418 TAGAAAATACGTAGCTACTATGG - Intronic
965742679 3:171892229-171892251 TTTCAACTACTTGGCTACTGTGG + Intronic
966346729 3:178989061-178989083 TGTAAGATGCTCAGGTACTGTGG + Intergenic
967217347 3:187221654-187221676 TGTATAAATATTAGCTACTGTGG + Intronic
967656014 3:192050067-192050089 TCTAAAATATGTAGCTATTGTGG - Intergenic
971726472 4:30319307-30319329 TATAATATCCTTAGCTACTGTGG - Intergenic
971865400 4:32164158-32164180 TGTGAAATCCTTAGATACAGAGG - Intergenic
974225813 4:59042191-59042213 TATAAAATAATAAGCTACTTTGG + Intergenic
975690595 4:76958617-76958639 TGTAATATACTAAGCTACTTTGG + Intronic
976032923 4:80779403-80779425 TGTATCCTACTTTGCTACTGTGG + Intronic
978678717 4:111351917-111351939 TATACAATACTTAGCTAATTAGG + Intergenic
979880393 4:125949656-125949678 TGTAACATACTTATCTAATATGG - Intergenic
980418197 4:132520969-132520991 TGCAAACTACTTTGCTACTAGGG - Intergenic
981886713 4:149683789-149683811 TGTAAAATATTTTGCTTCAGTGG - Intergenic
982141975 4:152332020-152332042 TCTAAAATATTTTGCTTCTGAGG + Intronic
982183262 4:152769452-152769474 TGTACAATACATAGTTACTTAGG + Exonic
982750436 4:159154639-159154661 TGTAAAATAATCTGCTTCTGGGG + Intronic
982759895 4:159269168-159269190 TGTAGAATATTTAGATGCTGAGG + Intronic
983286376 4:165744699-165744721 TGTAAAATAGTAAGCCACTTTGG + Intergenic
983351206 4:166591595-166591617 TTTAAAATAATTATCTACTTTGG + Intergenic
984671631 4:182495969-182495991 TGTAAAATGCTTAGCTTCCAAGG - Intronic
984972842 4:185206066-185206088 TGTAGCATACTCAGCCACTGTGG + Intronic
988989560 5:36656452-36656474 TGAAAAATATTTAGCTCATGTGG - Intronic
989447783 5:41551156-41551178 TATAAACTAGTCAGCTACTGTGG + Intergenic
990152950 5:52841073-52841095 TGGAAAATGCTTAAATACTGAGG + Intronic
990256162 5:53972368-53972390 TATAATATACTGTGCTACTGGGG - Intronic
990514109 5:56516287-56516309 TGTAAATGACTTAGTTACTTTGG - Intronic
991622715 5:68562174-68562196 TTTAAAATACATGGCTACTTGGG - Intergenic
992806158 5:80339851-80339873 TGTACTGTACTCAGCTACTGAGG + Intergenic
993695358 5:91054926-91054948 TGTAGATTACTTACCTACTCAGG - Intronic
993968174 5:94383832-94383854 TGTAAAATAATATGCTACTGTGG + Intronic
994595511 5:101827854-101827876 TGTAAATTATTTAGCTACTTTGG - Intergenic
995355669 5:111235683-111235705 TTTAAAATATTGACCTACTGAGG + Intronic
996016995 5:118550434-118550456 TGGAAACTACTGAGCAACTGAGG - Intergenic
997071276 5:130625435-130625457 TGTAAAATACTTCAGAACTGGGG + Intergenic
997580018 5:135011324-135011346 AGTAAAATACTTTGCTCCAGGGG + Intronic
1002854490 6:1025041-1025063 TGTAATAAACTAAGCTACTTGGG + Intergenic
1003342772 6:5237761-5237783 TGCAAAATGCTTTCCTACTGTGG + Intronic
1004253838 6:14044777-14044799 TTTGAAATACATAGCTTCTGTGG - Intergenic
1004818482 6:19338427-19338449 TGTAAAATTTCGAGCTACTGAGG - Intergenic
1005669445 6:28090459-28090481 TGTAAAAGCCTTACATACTGTGG - Intergenic
1008442425 6:51547634-51547656 TGGCAAATGCTCAGCTACTGTGG - Intergenic
1009759200 6:67981303-67981325 GGTAAAATTTTTAGCAACTGGGG + Intergenic
1009843501 6:69106693-69106715 TGTAAAGGACTGAGCTGCTGGGG + Intronic
1011108751 6:83813091-83813113 TGTAAAATACTGACATACTTAGG + Intergenic
1011889638 6:92141400-92141422 TGGAAAATATTTAGCTACAATGG - Intergenic
1011973269 6:93256352-93256374 GGGAAAACACTTAGCTATTGGGG - Intronic
1012368175 6:98468911-98468933 TGAAAAAGACTTATCTTCTGGGG - Intergenic
1012956021 6:105571071-105571093 TGTAAAATACATGGCATCTGTGG - Intergenic
1013431281 6:110057208-110057230 TGTTATATAATTAGCTTCTGGGG + Intergenic
1014021780 6:116599191-116599213 TGTAAAATACTGGTATACTGGGG - Intergenic
1014288967 6:119536397-119536419 TGGAAAATTCTTAGGTACTAAGG + Intergenic
1014811754 6:125894375-125894397 TCTAAATTATTTAGCTATTGTGG - Intronic
1014812238 6:125900251-125900273 TGGACAATACTTAACAACTGGGG - Intronic
1015711265 6:136143178-136143200 TGTAAAGTATTTAATTACTGGGG + Intronic
1016489824 6:144586711-144586733 TGTAAAATATTTAGCAATTGAGG + Intronic
1019491013 7:1313595-1313617 AGTAAAATAATTAGCAACAGAGG - Intergenic
1020414341 7:7928895-7928917 ATTAAAATACTTAGCTATTTTGG + Intronic
1020579255 7:9973561-9973583 TTTATAATACTTAGTTACCGTGG - Intergenic
1020941927 7:14550250-14550272 TCTAAAATACTTATTTACTAAGG + Intronic
1021541624 7:21765669-21765691 TGGAAAGCACTTACCTACTGAGG - Intronic
1026154228 7:67813204-67813226 TGTACAGTCCTTAGCTACTCTGG - Intergenic
1029429355 7:100519846-100519868 AGTAAAATAATTAGCCAGTGTGG - Intergenic
1029984157 7:104906541-104906563 TGTAAAATATATACGTACTGAGG + Exonic
1030938945 7:115620868-115620890 TGAAAAAGACTTTGCTTCTGAGG - Intergenic
1031148442 7:118024325-118024347 TGATAAATACTTAGCTGCTTTGG - Intergenic
1032063996 7:128750667-128750689 TTTAAAAAACTTATTTACTGTGG + Intronic
1032313229 7:130808439-130808461 TCTAAAATCCTTAGATTCTGTGG + Intergenic
1035691778 8:1563909-1563931 TGTAAAATACTTAGCTACTGAGG - Intronic
1036012701 8:4745681-4745703 TTCACAATTCTTAGCTACTGAGG + Intronic
1037217448 8:16474658-16474680 TGTAGAATATTTAGCAACTGTGG - Intronic
1044719485 8:95132043-95132065 TGTAATATACCCAGCTACTCAGG - Intergenic
1045640058 8:104239678-104239700 TGTAAAAAACTTATCTACAAAGG + Intronic
1045867711 8:106887482-106887504 TGTAAGGTACATAGCTATTGGGG + Intergenic
1046072050 8:109267450-109267472 TGTAAATTAGTTAGCTATTGTGG + Intronic
1046990710 8:120449723-120449745 TTTAAAACACTTGGCTTCTGTGG - Intronic
1047333889 8:123918390-123918412 TCTCAAATACTTATCAACTGGGG - Intronic
1048363669 8:133719587-133719609 TGGAAAATACTTTGGAACTGAGG + Intergenic
1048846607 8:138608465-138608487 TTTAAAATACGTAGATACTGAGG + Intronic
1049076482 8:140400340-140400362 TGCAAAATAGCAAGCTACTGTGG - Intronic
1050639467 9:7651883-7651905 ACTAAAATACTTAGCAACTGCGG + Intergenic
1050755314 9:8995485-8995507 TGTAAAATAGTGACCCACTGTGG - Intronic
1051118056 9:13720048-13720070 TGCAAGAGACTTTGCTACTGGGG - Intergenic
1052201643 9:25789148-25789170 TGTAAAAAATTTAGGAACTGAGG - Intergenic
1052895023 9:33739117-33739139 TGTAAAATACTTGACCAATGAGG + Intergenic
1057984738 9:99701771-99701793 TGAAAAATACTTTACTACAGGGG - Intergenic
1058260785 9:102828268-102828290 TGTAAAATATTTAACTTATGAGG - Intergenic
1059500865 9:114752912-114752934 AATAAAATATTTATCTACTGGGG + Intergenic
1060534904 9:124377607-124377629 TGCCAAACACCTAGCTACTGAGG - Intronic
1187309207 X:18124714-18124736 TGTAAATCACTGAGCTATTGGGG + Intergenic
1189725885 X:43967920-43967942 TGAAAAATTCTTAGCTTTTGTGG + Intronic
1190528945 X:51355572-51355594 TGTACAGTACTTTGTTACTGAGG + Intergenic
1193255735 X:79346905-79346927 TATAAAATACTTAACCAATGAGG + Intergenic
1193376084 X:80763367-80763389 TGAAACATAGTTAGCTATTGGGG - Intronic
1193950537 X:87792406-87792428 TGTAAACTAGTTAACTACTATGG - Intergenic
1195253055 X:103066738-103066760 TGTAAAATATTCAGCCACTTTGG - Intergenic
1197329043 X:125131167-125131189 TATTAAATCCTAAGCTACTGTGG + Intergenic
1197530575 X:127619481-127619503 TGTCACATTCTGAGCTACTGAGG - Intergenic
1197912568 X:131500130-131500152 TATAAAATACTTTGCTATTTGGG - Intergenic
1198957969 X:142152533-142152555 TGTAAACTAGTTAGGCACTGTGG - Intergenic