ID: 1035691782

View in Genome Browser
Species Human (GRCh38)
Location 8:1563952-1563974
Sequence GTCTGAAGACCTTTTAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035691778_1035691782 20 Left 1035691778 8:1563909-1563931 CCTCAGTAGCTAAGTATTTTACA 0: 1
1: 0
2: 1
3: 22
4: 197
Right 1035691782 8:1563952-1563974 GTCTGAAGACCTTTTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035691782 Original CRISPR GTCTGAAGACCTTTTAAATA TGG Intronic
No off target data available for this crispr