ID: 1035692066

View in Genome Browser
Species Human (GRCh38)
Location 8:1566704-1566726
Sequence GGATAGAGACAATACAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035692066 Original CRISPR GGATAGAGACAATACAGGGA GGG (reversed) Intronic
901427375 1:9191012-9191034 GGAGACAGACAATAAACGGATGG - Intergenic
902847897 1:19126661-19126683 AGACAGAGAAAATACAGAGATGG + Intronic
906551500 1:46669514-46669536 GGATAAAGACTATAAAGAGATGG - Intronic
907264705 1:53250517-53250539 GGAAAGAAAAAAGACAGGGAGGG + Intronic
907303782 1:53502959-53502981 GGATAGAGAGGAAACGGGGAGGG + Intergenic
909338201 1:74501162-74501184 GGATAGAGAAAGTAAAGGGTGGG - Intronic
909518610 1:76541029-76541051 GGTTAGAGAAAATACAGGAAGGG + Intronic
910715870 1:90229520-90229542 GGAGATAGAGAATACAAGGATGG - Intergenic
911491569 1:98575554-98575576 GGAGAAAGGCAATAGAGGGAAGG + Intergenic
911783433 1:101912897-101912919 GGATATAAAAAACACAGGGAAGG + Intronic
912369523 1:109163200-109163222 GGGTAGAGGCAACACAGAGAAGG + Intronic
912958641 1:114175062-114175084 GGAAAAAGACAATAGAGGGATGG + Intergenic
913471980 1:119197151-119197173 GGTTAAAAAAAATACAGGGAAGG - Intergenic
913530067 1:119727501-119727523 GGAGAGAGAGAATTCAGGGTGGG + Intronic
913706580 1:121430696-121430718 GGATGGATGCAATATAGGGAAGG + Intergenic
915566949 1:156720146-156720168 GGACAGAGACAGAACAGGAAGGG + Intergenic
917628811 1:176873157-176873179 GGAAAGAGCAAATAAAGGGATGG + Intronic
917969882 1:180199722-180199744 GGATAGAGACCAAGCAGGGAGGG + Exonic
918065501 1:181098334-181098356 GAATAAAGAAACTACAGGGAAGG + Intergenic
919780871 1:201220153-201220175 GGATAGAAAGAAGAGAGGGAGGG - Intronic
919827531 1:201514054-201514076 GAATGGAGACTTTACAGGGAGGG + Intergenic
920692566 1:208158277-208158299 GGAGAGAGACAAGGAAGGGAAGG - Intronic
922605337 1:226886698-226886720 GGACAGGGACAGTGCAGGGAGGG + Intronic
922737384 1:227994819-227994841 GGGGAGAGACACTACAGGGCGGG - Intergenic
924646166 1:245878819-245878841 GGAGAGGGACAACGCAGGGATGG + Intronic
924927459 1:248696732-248696754 GGAGAGAGACAAAACAGGACAGG - Intergenic
1064447114 10:15405646-15405668 GGAGATAGAGAATAGAGGGATGG + Intergenic
1070538020 10:77393874-77393896 GGACAGAGACAAGACAGGACCGG + Intronic
1072273412 10:93799675-93799697 GGATTGAGACAGTACATGCAAGG + Intergenic
1073649178 10:105340744-105340766 GGAGAGAGGCAGCACAGGGAAGG - Intergenic
1073660685 10:105472693-105472715 TGTTAGAGAAAATACAAGGAGGG - Intergenic
1073818763 10:107236328-107236350 AGATAGAGACAATACTGAGTAGG + Intergenic
1074730106 10:116362695-116362717 AGATGGAGACAATATAGGTAAGG - Intronic
1075650594 10:124126265-124126287 GGAGAGAAACAGTACAGAGATGG - Intergenic
1075670534 10:124261197-124261219 AGATAGAGCCAGAACAGGGAAGG + Intergenic
1078922346 11:15842376-15842398 GAAGAGAGACAAAGCAGGGAGGG + Intergenic
1079299352 11:19263832-19263854 CTATGGAGACAAAACAGGGAAGG + Intergenic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1080232921 11:30037865-30037887 GGAAAGAGACAAGAGAAGGAGGG + Intergenic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1085030800 11:73269843-73269865 GGAAAGAGACAAGGCTGGGAAGG - Intronic
1085989367 11:81822721-81822743 GGATAGAGAGATTACAGGAGAGG - Intergenic
1086351160 11:85943997-85944019 CCATACAGACAATACAAGGAGGG - Intergenic
1087118691 11:94550182-94550204 AGCTAGAGACAATACATGGAGGG - Intronic
1089768260 11:120784252-120784274 GGAAGGAGCCAGTACAGGGAAGG - Intronic
1090252669 11:125262617-125262639 GGGTAGAGAAAGGACAGGGAGGG - Intronic
1091159174 11:133404149-133404171 AGACACAGCCAATACAGGGAGGG - Intronic
1092288266 12:7142525-7142547 GGAAAGAGTCAAAACAAGGAGGG - Intronic
1092634509 12:10427532-10427554 GGAGAGAGACAGTAGAAGGATGG + Intronic
1092635553 12:10442955-10442977 GGAGAGAGACAGTAGAAGGATGG + Intronic
1092897887 12:13031123-13031145 AGAAAGAGTCACTACAGGGATGG + Intergenic
1092994923 12:13940811-13940833 GGAGAGAGATAATACAGAGATGG - Intronic
1093749085 12:22778329-22778351 GGCTAATGACAATACAGTGAAGG + Intergenic
1095149056 12:38769304-38769326 GTATAGTGACAATAGAGGTAAGG + Intronic
1095635505 12:44428697-44428719 GGGGAGAGAACATACAGGGATGG + Intergenic
1096265111 12:50116436-50116458 GGATTAAGACAAGAGAGGGAAGG + Intronic
1097661337 12:62434887-62434909 GCAGAGTGACAATACAGGAAGGG + Intergenic
1098673299 12:73256369-73256391 GGATAAAGGCAATACAATGAAGG - Intergenic
1099006322 12:77238567-77238589 GAATAGAAACAATTCAAGGACGG - Intergenic
1099130332 12:78821221-78821243 GGATAGAGGCAGCACAGGGCTGG + Intergenic
1099282137 12:80663989-80664011 GGATATATACAATAGAGGAAAGG - Intronic
1101266570 12:103094386-103094408 GGATTAAGACAATTCAGGAATGG - Intergenic
1102641077 12:114367142-114367164 GGGCAGAGAGAATAGAGGGAGGG + Intronic
1103623068 12:122200597-122200619 GGAGAAAGACAAGAAAGGGAAGG + Exonic
1104773765 12:131380868-131380890 GGGGAGAGAAAATAGAGGGAGGG - Intergenic
1106561758 13:30852470-30852492 GGATAGAAAGAATCCAGGAAAGG - Intergenic
1107126380 13:36851045-36851067 GGATAGATATTATACAGGCAAGG - Intronic
1107204829 13:37771920-37771942 GCATGGAGACAATAGAGGTAAGG + Intronic
1108803285 13:54126579-54126601 GCAGGGAGACCATACAGGGAGGG - Intergenic
1115125833 14:29992685-29992707 GGAGAGAGAGAGTACAGGAATGG + Intronic
1116413468 14:44652163-44652185 GGAGAGAGACAGTAGAAGGATGG + Intergenic
1116529737 14:45955291-45955313 GAAGAGAGACAATAAAGGGAAGG - Intergenic
1117977701 14:61314760-61314782 TGAGAGAGAGAATAAAGGGAAGG - Intronic
1118609432 14:67528650-67528672 GGATAGGGACAGGAGAGGGAGGG - Intronic
1120267466 14:82269590-82269612 GGAAGGAGAGAAGACAGGGAAGG + Intergenic
1122191184 14:100044998-100045020 GCATAGAGACAATAAAAGGAGGG + Intronic
1123849580 15:24341470-24341492 GGAAAGAGGCAAAAAAGGGAAGG + Intergenic
1125538629 15:40457273-40457295 GGGTAGAGAAAACCCAGGGACGG - Intronic
1127597926 15:60505458-60505480 GGATTGAGGCAATATTGGGAAGG - Intronic
1128565103 15:68695908-68695930 GGAAAGAGACAATTTAGAGAGGG + Intronic
1128719583 15:69938509-69938531 GGCTAGAGACAATAGAGAAAAGG - Intergenic
1128856297 15:71019390-71019412 GAATGGAGAGAATACAGGGATGG + Intronic
1129282511 15:74497096-74497118 GGATATAAAGGATACAGGGATGG - Intergenic
1130133207 15:81160736-81160758 GCACAGAGACGATGCAGGGATGG - Intronic
1130309294 15:82739016-82739038 TGGTTGAGACAATATAGGGAGGG - Intergenic
1130663610 15:85850990-85851012 GGAAAGATACAACAGAGGGAAGG + Intergenic
1131926141 15:97385976-97385998 TGATGGAAACAATACTGGGAAGG + Intergenic
1132021702 15:98368202-98368224 GAATATAGAGACTACAGGGAGGG - Intergenic
1133517535 16:6524168-6524190 GGAGATAGAGAGTACAGGGATGG - Intronic
1133959060 16:10476459-10476481 GGGGAGAGTAAATACAGGGATGG - Intronic
1134316950 16:13127364-13127386 GGAGAGAGAAAAGAGAGGGAGGG + Intronic
1135157447 16:20065013-20065035 GGATCGAGGAAAAACAGGGATGG - Intronic
1135482047 16:22828819-22828841 TGCTAGAGAAAATACAGGAAAGG - Intronic
1137593810 16:49710555-49710577 GGATGGAGAGGATGCAGGGATGG - Intronic
1140814524 16:78608810-78608832 GGCTAGAAAAAATAAAGGGAGGG - Intronic
1144409451 17:14986394-14986416 GAAGAGTGACAACACAGGGAAGG + Intergenic
1146446635 17:32937432-32937454 GGAGGGAGATAATCCAGGGAGGG + Intronic
1146468592 17:33106741-33106763 GGAAAAAAAAAATACAGGGAAGG - Intronic
1146822914 17:35998927-35998949 TGAAAGAAACAGTACAGGGAAGG + Intronic
1147809573 17:43158801-43158823 GGATAGATACATTACATAGAAGG + Intergenic
1147955606 17:44132400-44132422 GGATAGAGACAACTCTGGGCTGG + Intergenic
1148202381 17:45757859-45757881 GGACAGGGGCAATGCAGGGAGGG + Intergenic
1148821478 17:50362228-50362250 GGATTGAGATACTACAGGCATGG - Intronic
1149070561 17:52537034-52537056 AGAGAGAGACAATAAAGGAAAGG + Intergenic
1149453369 17:56767344-56767366 GGATAGGGACATAACAGGGAGGG - Intergenic
1153190126 18:2528949-2528971 TTAAAGAGACAATAGAGGGAAGG - Intergenic
1153309339 18:3662833-3662855 GTATACTGATAATACAGGGATGG - Intronic
1154932060 18:21009359-21009381 AGATACATACAATACAGAGATGG - Intronic
1155523792 18:26696177-26696199 GCATAGATACAAAAAAGGGAGGG + Intergenic
1155611023 18:27667790-27667812 GGATGGAGTCAGTAGAGGGAAGG - Intergenic
1158120736 18:54045773-54045795 GGATAGAGAGAAGCCAGGGCTGG - Intergenic
1159229273 18:65584698-65584720 GGAAATAGAGAATACAGTGATGG - Intergenic
1160593829 18:79961058-79961080 TGATGGAGACAACACAGTGAAGG - Intergenic
1161369027 19:3899197-3899219 GAATAGAGAAAAGAGAGGGAGGG + Intronic
1161663742 19:5562615-5562637 GGAAAGAGAGAAAGCAGGGATGG + Intergenic
1163719073 19:18889780-18889802 GGATGGAGACAAGGCAGGGGTGG - Intronic
1164735531 19:30538363-30538385 GGACAGAAAAAATACAGAGAAGG - Intronic
1166326741 19:42055638-42055660 GGAAAAAGACAAGGCAGGGAGGG + Intronic
1166564710 19:43756678-43756700 TGATAGACATAATACAGAGATGG - Intergenic
1167762489 19:51458311-51458333 GGAGACAGACAATATGGGGATGG - Exonic
1167850791 19:52200151-52200173 GGATAGAGGCAGAACAGGTAGGG - Intronic
1167898297 19:52599538-52599560 GGATAGATACACTTCAAGGAAGG - Intronic
925047216 2:781813-781835 GGGTGGAGACGACACAGGGACGG - Intergenic
926555709 2:14355491-14355513 GGATTGAGAGAATTGAGGGATGG - Intergenic
926998700 2:18769182-18769204 GGACAGAGAGAATACAGTTAGGG - Intergenic
928069719 2:28202399-28202421 GAAGAGAGAGAAGACAGGGAAGG - Intronic
929323202 2:40571846-40571868 GGAGAGAGACGAGACAGGAATGG - Intronic
932791374 2:74656685-74656707 GGTGAGAGACAAGAGAGGGAAGG + Exonic
933179565 2:79213977-79213999 GGACAGAAACACTACAGGGTGGG + Intronic
935496717 2:103791546-103791568 GGAGATAGACAATAGAAGGATGG + Intergenic
936149035 2:110001455-110001477 AGAGAGAGAGAAAACAGGGAGGG + Intergenic
936195646 2:110369915-110369937 AGAGAGAGAGAAAACAGGGAGGG - Intergenic
937048818 2:118871450-118871472 GGAGACAGAGAACACAGGGAGGG - Intergenic
937664047 2:124463983-124464005 GGTTAGAGAAAAAACAGTGAAGG + Intronic
938244855 2:129768517-129768539 GGGTAGAGCTAATACCGGGATGG - Intergenic
939242331 2:139576949-139576971 GGAGATAGACAGTACAAGGATGG - Intergenic
939684023 2:145175171-145175193 GGATAAAGAAAATACAGGCCGGG - Intergenic
940069633 2:149671452-149671474 AGATAGAGAAAAAACAGGGAGGG - Intergenic
940784053 2:157962994-157963016 GGAAAGAGACAGTGAAGGGAAGG + Intronic
941323128 2:164080460-164080482 AGCTAGAGACAAAAGAGGGAGGG - Intergenic
941493810 2:166175885-166175907 TGATGATGACAATACAGGGAGGG - Intergenic
942749220 2:179268987-179269009 GGATAAAAATAATGCAGGGAAGG + Intergenic
943165514 2:184319218-184319240 GGATAGAGAAAATATAGCAATGG - Intergenic
943783351 2:191849029-191849051 GAATAGAGACATTAAAGAGATGG + Intergenic
944809042 2:203309952-203309974 GGAGAAAGACAGTACAGTGATGG - Intergenic
946158558 2:217822339-217822361 GGATACAGGCAAGGCAGGGATGG - Intronic
946786153 2:223246413-223246435 GGATAGAGACCCTAAGGGGAGGG - Intergenic
947671567 2:231939944-231939966 GAATACAGATAATACAGGGCTGG + Intergenic
1169069755 20:2717318-2717340 GGAGAGAGAATATATAGGGATGG + Intronic
1169313955 20:4572410-4572432 GCAAAGAGTGAATACAGGGAGGG + Intergenic
1169719380 20:8657106-8657128 AGACAGAGAAAAAACAGGGAGGG + Intronic
1169974707 20:11311562-11311584 AGACAGAGTAAATACAGGGACGG - Intergenic
1171432695 20:25094063-25094085 AGATAAAGACATTACAGGAAAGG + Intergenic
1171471816 20:25378209-25378231 GCAAAGAGAAAATACAGGGATGG - Intronic
1172528352 20:35614714-35614736 GGAGAAAAACAAAACAGGGAAGG + Intergenic
1173094619 20:40013256-40013278 CCATAGAGGAAATACAGGGAGGG - Intergenic
1173133263 20:40414566-40414588 GGAAAGAGAGAAAAGAGGGAAGG + Intergenic
1173850346 20:46213948-46213970 GGAGAGAGATAAAGCAGGGAAGG + Intronic
1174520110 20:51122786-51122808 GCAAGAAGACAATACAGGGAAGG + Intergenic
1176140306 20:63542002-63542024 GGCTGGAGACCAGACAGGGATGG + Intronic
1177134755 21:17297103-17297125 GGATAGAAACAGAACATGGAAGG + Intergenic
1177191457 21:17856407-17856429 GGATGAAGATAATAGAGGGAAGG - Intergenic
1177197384 21:17917604-17917626 GGATGCAGACAACCCAGGGAAGG + Intronic
1177480342 21:21678278-21678300 GTATATACCCAATACAGGGATGG + Intergenic
1178194400 21:30326980-30327002 GGAGAAAGACAATTCAGGGTAGG + Intergenic
1178264136 21:31126731-31126753 GGAGGGAGAGAATACAAGGAAGG + Intronic
1179570225 21:42274184-42274206 TGAAAGGGAAAATACAGGGAAGG + Intronic
1180655950 22:17420972-17420994 GGACAGCAACGATACAGGGATGG - Intronic
1181349936 22:22247696-22247718 GGATGGAGGCAAGAGAGGGACGG - Intergenic
1181878310 22:25957275-25957297 GGAAAGAGAGAAAAGAGGGAAGG - Intronic
1182388743 22:29971618-29971640 TTAAAGAGACAAAACAGGGAAGG - Intronic
1183837248 22:40464967-40464989 GGAGAGAGACACTACAGGCAAGG - Intronic
1183879076 22:40811155-40811177 GGATGGAGAGAATAAAGAGAGGG - Intronic
1184167757 22:42740457-42740479 GGATAATGACATAACAGGGAGGG + Intergenic
949627831 3:5887856-5887878 GGACAGAGAGAGTAGAGGGAAGG + Intergenic
952468133 3:33613374-33613396 GGATATGGGCAATACTGGGAAGG + Intronic
954494944 3:50948933-50948955 GAATAGAGACAATTCAGATATGG + Intronic
955241250 3:57180228-57180250 TGAGAGAGACAATGCAAGGAAGG - Intergenic
956362653 3:68465717-68465739 GGAAAGAGAAAAGACAGAGAGGG + Intronic
956587622 3:70881219-70881241 GGAATGAGACAACACTGGGAGGG + Intergenic
956904956 3:73756311-73756333 CATTAGAGACAATGCAGGGAAGG + Intergenic
959090936 3:101901985-101902007 GGATACAGAGAAAACAGGGGCGG - Intergenic
960106128 3:113799114-113799136 AGATAAAGACAATACAAGAAAGG + Intronic
961188092 3:124933425-124933447 GGATAATGACATAACAGGGAGGG - Intronic
962412117 3:135150409-135150431 GGATAAAGACAGTTCAGGGAAGG - Intronic
963685984 3:148434539-148434561 GGATTGAGAGAAGACAGGGAAGG + Intergenic
964408063 3:156370679-156370701 GGAGAGATACAATCCAGGGAGGG - Intronic
964428320 3:156576731-156576753 GGACAAACACAATAAAGGGAGGG + Intergenic
964489201 3:157216866-157216888 GGAAAGAGAGAACATAGGGAAGG + Intergenic
964705212 3:159611097-159611119 GTATAAAGCCAATACAGGCAGGG + Intronic
964807048 3:160621767-160621789 GAAGAGTGACTATACAGGGATGG - Intergenic
965976955 3:174637147-174637169 TGATAGATACCAGACAGGGAAGG + Intronic
966262506 3:177996343-177996365 GGAAAGAGAGAATAAAGAGATGG - Intergenic
968559399 4:1270311-1270333 AGATAGAGAAAATACAGGCCAGG - Intergenic
970014023 4:11492579-11492601 TAATAGCGACAAGACAGGGAAGG - Intergenic
971219652 4:24693221-24693243 GGACAGAGCCACGACAGGGAAGG - Intergenic
972922121 4:43957020-43957042 GTATATATACAGTACAGGGAGGG + Intergenic
973574075 4:52268332-52268354 GGATATAGTCCATACAGGAAAGG + Intergenic
976382634 4:84417622-84417644 CGAGAGAGACAATACAGAAAAGG + Intergenic
976969370 4:91085966-91085988 GACTAGAGACAGTACAAGGAGGG + Exonic
977577548 4:98691012-98691034 GCATAGTGCCAGTACAGGGAGGG + Intergenic
977641646 4:99364099-99364121 GGAGAGAGAGAATAGAAGGATGG - Intergenic
978609378 4:110520626-110520648 GAATAAAGAAAATAAAGGGAGGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979749655 4:124263012-124263034 GGAAAGAAAGAATAAAGGGAAGG - Intergenic
981240978 4:142475158-142475180 GCATAGAGACAATAACTGGAGGG + Intronic
981910118 4:149969461-149969483 GGATTGAGTCAATTTAGGGAAGG - Intergenic
982720247 4:158852215-158852237 GGATGGAGAAAATACAGTGATGG + Intronic
984215292 4:176904966-176904988 GGACAGAGACAAGAAAAGGAAGG + Intergenic
984399884 4:179248901-179248923 GGATTGAGACAATAAAGCAATGG + Intergenic
985571433 5:647609-647631 GGGTAGAAACAGCACAGGGAGGG + Intronic
985702994 5:1384751-1384773 GGGTGGAGAAAGTACAGGGAGGG + Intergenic
985811155 5:2087517-2087539 AGAGAGAGAGAATTCAGGGAGGG + Intergenic
986415975 5:7528587-7528609 GGATAGAGACAGTTAATGGATGG - Intronic
987112511 5:14701011-14701033 GGAGGGAGCCAAGACAGGGAGGG + Intergenic
987422497 5:17736919-17736941 GTATAGACACAATACTGGGCTGG - Intergenic
987849150 5:23326310-23326332 GGAGGGAGAGAATTCAGGGAAGG + Intergenic
988191161 5:27936874-27936896 GGCTAGAGACTATCCTGGGAGGG + Intergenic
990255183 5:53961022-53961044 AGATAGAGAAACTAAAGGGAAGG - Intronic
995504305 5:112843054-112843076 GGATAGAGACATATCAGGAAGGG - Exonic
997833057 5:137169148-137169170 GGATATAGAGAATAGAAGGATGG + Intronic
997943739 5:138181214-138181236 GGATAATGACGAGACAGGGAAGG + Intronic
998606266 5:143638328-143638350 GGATAGATGAAATACAGGGCTGG + Intergenic
999405612 5:151304206-151304228 GTATAGAGAAAATCCAGGCAAGG + Intergenic
999540586 5:152567655-152567677 AGTTAGAGACACTAGAGGGAGGG + Intergenic
1000245807 5:159447549-159447571 GGATGGAAACAAACCAGGGAAGG + Intergenic
1004782023 6:18920105-18920127 GGAGATAAATAATACAGGGAAGG - Intergenic
1005367548 6:25094369-25094391 GGATAAAGAAAATATAAGGAGGG + Intergenic
1006018269 6:31100282-31100304 GGACAGAGACAGTAGAAGGATGG - Intergenic
1007267393 6:40607303-40607325 GGATAGAGACAATGATTGGAGGG + Intergenic
1008139996 6:47821302-47821324 TGATAGAGACTGCACAGGGAGGG + Intronic
1008428954 6:51392351-51392373 GGGTAGAGAAACCACAGGGATGG + Intergenic
1010514064 6:76752438-76752460 GGAAAGAGGCACTAGAGGGAAGG + Intergenic
1010682375 6:78811746-78811768 GGATAGAGATAAGTCAGGGTTGG - Intergenic
1011624798 6:89273939-89273961 GGGAAGAAACAATACAGCGATGG + Intronic
1011957319 6:93038988-93039010 AGAAAGAGACAGTACAGAGAGGG + Intergenic
1012264319 6:97122700-97122722 GCATAGAGACAATCCACAGAGGG - Intronic
1012658979 6:101862157-101862179 GGATAATGAGATTACAGGGAGGG + Intronic
1012785588 6:103621469-103621491 GGAAAGAGAGCATAGAGGGATGG - Intergenic
1012815791 6:104019981-104020003 AGATATAGACAATACAGTGATGG + Intergenic
1014639817 6:123895131-123895153 GGAAAGAGAGAAGAAAGGGAAGG - Intronic
1014754681 6:125289791-125289813 GGTTAGAAACAATCCAAGGACGG + Intronic
1015922823 6:138282327-138282349 GGATACAGACACTCCAGAGAGGG - Intronic
1016871875 6:148825831-148825853 GAAAAGAGGAAATACAGGGAAGG + Intronic
1019255334 7:46239-46261 GGTTAGAGACAGGGCAGGGACGG + Intergenic
1020376544 7:7493740-7493762 GGGTAAAAACAAAACAGGGAGGG + Intronic
1021931974 7:25590027-25590049 GGGTAGAGACAACATAGGAAGGG - Intergenic
1023477077 7:40592456-40592478 GGGTAGAGAGCATGCAGGGAAGG + Intronic
1026400107 7:70001435-70001457 TGATAAAGACTATAAAGGGAAGG + Intronic
1026819394 7:73536813-73536835 GGGTAGAGACATTGGAGGGAAGG - Exonic
1026832344 7:73617982-73618004 GGATGGAGACGAGAGAGGGAGGG - Intronic
1027802278 7:82770086-82770108 GAATAGAAACAATAAAAGGAAGG - Intronic
1028063191 7:86347403-86347425 GGATAGAGTCATTACAGAAAAGG - Intergenic
1028613175 7:92734737-92734759 GGATAGGGACAAAAGAGGCATGG + Intronic
1028718265 7:93999777-93999799 GGAAAGAGCCAAAGCAGGGAGGG + Intronic
1030896307 7:115065180-115065202 AGATAGGGACAAAATAGGGAAGG - Intergenic
1032122365 7:129166374-129166396 AGATAGAGAAAACACAGGGGAGG - Intronic
1034128661 7:148697052-148697074 GGAAACAAACAATACAGGGAAGG + Intergenic
1035055489 7:156032364-156032386 GGACAGAGATATTGCAGGGAAGG - Intergenic
1035067069 7:156113921-156113943 GGAGAAAGACAAAGCAGGGATGG - Intergenic
1035080191 7:156209349-156209371 GGAAAGAGACAGAAAAGGGAAGG + Intergenic
1035692066 8:1566704-1566726 GGATAGAGACAATACAGGGAGGG - Intronic
1038081678 8:24144350-24144372 AGACAGAGACAATGCAGGGAAGG + Intergenic
1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG + Intronic
1041948144 8:63470109-63470131 GAATAAACACAACACAGGGAAGG + Intergenic
1043927197 8:86050796-86050818 TGGCAGAGACAATACATGGAAGG - Intronic
1044998411 8:97858905-97858927 GGAAAGAGTCAAGACAGGGCCGG - Intergenic
1045064662 8:98434831-98434853 GGATAGAGTGAATAAAGGAAAGG + Intronic
1047375203 8:124289235-124289257 AGATATAGACAACCCAGGGAAGG + Intergenic
1047846228 8:128808397-128808419 GAAAAGAGAGAATAAAGGGAAGG - Intergenic
1048720881 8:137323193-137323215 GCATAGATTCAAGACAGGGATGG - Intergenic
1049347860 8:142148266-142148288 TGCCAGAGACACTACAGGGAGGG - Intergenic
1051522842 9:18009643-18009665 GGATAAGAACAATACAGAGAAGG + Intergenic
1051743542 9:20274227-20274249 GGATATAGCCAAAACAGGGGAGG + Intergenic
1052485929 9:29100193-29100215 GGATATAGAGAATAGAAGGATGG + Intergenic
1052486075 9:29101589-29101611 GGATATAGAGAATAGAAGGATGG - Intergenic
1054792401 9:69268288-69268310 GGAGAGAGAAACTCCAGGGATGG + Intergenic
1055252310 9:74322598-74322620 GGATAGAGGCAAGACAGAGCAGG + Intergenic
1056607367 9:88097428-88097450 GGATGGAGACCACAGAGGGAGGG + Intergenic
1056958618 9:91102291-91102313 GAAGAGAGACAGGACAGGGAAGG + Intergenic
1057647309 9:96888919-96888941 GGAGAGAGACAGTCCAGGGCCGG - Intergenic
1058187808 9:101875821-101875843 GGTTGGAGACAACACTGGGATGG - Intergenic
1058187819 9:101875909-101875931 GGGTGGAGACAACACTGGGATGG - Intergenic
1059309913 9:113381247-113381269 GGAGAGAGAGAAAAGAGGGAGGG - Intergenic
1059975629 9:119713745-119713767 GGGTAGAGACAATGCAGGCTTGG + Intergenic
1060639217 9:125224747-125224769 GGATACAGACAATACTGGCCGGG - Intronic
1060755123 9:126207045-126207067 GGATAGAGGCAAATCAGGGAAGG - Intergenic
1062640244 9:137515053-137515075 GGAGAGGGACCATGCAGGGAGGG + Intronic
1185813822 X:3135466-3135488 GGAAAGAAAGAATACATGGATGG + Intergenic
1186892676 X:13974946-13974968 GGAGAAAGACAAAACAGGGAAGG - Intergenic
1187804663 X:23106124-23106146 GCAAAGAGAGAATACAGGGAGGG + Intergenic
1187900261 X:24021636-24021658 GGATGGATACAAAACATGGAAGG - Intronic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1188474304 X:30574002-30574024 GGATAAAGTCCATACAGGGTAGG + Intronic
1188899886 X:35717887-35717909 GAAAAGAGACAACACAAGGATGG - Intergenic
1190178040 X:48167608-48167630 GGACAGAGAGAGTGCAGGGAGGG + Intergenic
1190199094 X:48345017-48345039 GGAGAGAGAGAGTGCAGGGAGGG - Intergenic
1190476366 X:50831966-50831988 TGATAGTGACAGTTCAGGGATGG - Intergenic
1190665855 X:52695485-52695507 GGAGAGAGAGAGTGCAGGGAGGG - Intronic
1190673563 X:52762925-52762947 GGAGAGAGAGAGTGCAGGGAGGG + Intronic
1191937695 X:66442856-66442878 GGAGAGAAAGAAGACAGGGAAGG - Intergenic
1192990096 X:76442924-76442946 GGAGATAGACAATAGAAGGATGG - Intergenic
1194073329 X:89355156-89355178 GGATAGAGAAAATCTAGGGTTGG - Intergenic
1194235162 X:91373834-91373856 GGACATAGAGAATAGAGGGATGG + Intergenic
1195735742 X:108010785-108010807 GAGTAGAGACAAAGCAGGGAGGG - Intergenic
1198294215 X:135270059-135270081 GGATATAGAGAATAGAAGGATGG + Intronic
1199197752 X:145051654-145051676 GGATATAGAGAATACAGAGATGG + Intergenic
1199843028 X:151670112-151670134 GGATAGAGATAATAGGGGCATGG - Intronic
1200727559 Y:6690959-6690981 GGATAGAGAAAATCTAGGGTTGG - Intergenic
1200728710 Y:6706734-6706756 GGATAGAGAAAATCTAGGGTTGG - Intergenic
1201943649 Y:19486041-19486063 GAACAGAGACAAGACAAGGATGG + Intergenic