ID: 1035693764

View in Genome Browser
Species Human (GRCh38)
Location 8:1577836-1577858
Sequence CAGGGGCAGGTTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1227
Summary {0: 1, 1: 1, 2: 15, 3: 122, 4: 1088}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035693764_1035693775 4 Left 1035693764 8:1577836-1577858 CCTTCCTCCTCAACCTGCCCCTG 0: 1
1: 1
2: 15
3: 122
4: 1088
Right 1035693775 8:1577863-1577885 CGCAAGTCCTGAGCCCCGCCCGG No data
1035693764_1035693783 24 Left 1035693764 8:1577836-1577858 CCTTCCTCCTCAACCTGCCCCTG 0: 1
1: 1
2: 15
3: 122
4: 1088
Right 1035693783 8:1577883-1577905 CGGTGCCTCCGAGGTGCCACTGG No data
1035693764_1035693777 15 Left 1035693764 8:1577836-1577858 CCTTCCTCCTCAACCTGCCCCTG 0: 1
1: 1
2: 15
3: 122
4: 1088
Right 1035693777 8:1577874-1577896 AGCCCCGCCCGGTGCCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035693764 Original CRISPR CAGGGGCAGGTTGAGGAGGA AGG (reversed) Intronic
900309027 1:2024591-2024613 CGCGGGCTGGTTGAGGAGGGAGG + Intronic
900400319 1:2470362-2470384 CAGGGCCAGCTTGAGCAGGGAGG + Intronic
900672885 1:3866725-3866747 CAGGGGCTGGCGGAGGGGGAAGG - Intronic
900700803 1:4047556-4047578 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
900809095 1:4787604-4787626 CAGGGGCAGGGGCAGGATGAGGG + Exonic
901024777 1:6273393-6273415 CAGGGGCAGCTTCAGGATGCAGG + Intronic
901056070 1:6449097-6449119 TAGGGGCAGGTTGAGGGGCGTGG + Intronic
901079217 1:6574458-6574480 CTGGGGCAGGTTCTGGGGGAGGG - Intronic
901813093 1:11778843-11778865 CTGGGGCAGGTAGGGGTGGATGG + Intronic
901852783 1:12026597-12026619 AAGGGGCAGGATGAGGATGCAGG - Intronic
901936307 1:12629558-12629580 CCTTGGCAGGTTGGGGAGGAGGG + Intergenic
902387306 1:16083287-16083309 CAGGGGGTGGCTCAGGAGGAGGG - Intergenic
902411244 1:16212661-16212683 GAGGGGGAGGTGAAGGAGGAGGG + Intergenic
902478284 1:16699398-16699420 TAGGGGCAGGTTGAGGGGTGGGG - Intergenic
902618117 1:17634908-17634930 CAGGTGCAGGTGGTGGAGGTGGG + Exonic
902707025 1:18212689-18212711 CAGGGGCATGTTGAGCAGAGGGG - Intronic
902726693 1:18340941-18340963 GAGGGGGAGGGGGAGGAGGACGG - Intronic
902864664 1:19270213-19270235 CAGGGGAAGGTAGGGAAGGAAGG + Intergenic
902866887 1:19285649-19285671 CAGGGGAAGGTAGGGAAGGAAGG + Intronic
903364701 1:22798836-22798858 CAGGAGCAGGATGAGAAGGGAGG + Intronic
903391991 1:22971221-22971243 CAGCTGCATTTTGAGGAGGAGGG - Intergenic
903529691 1:24020723-24020745 GAGGGGCAAGTTGGGGAGGAGGG - Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
903970916 1:27118254-27118276 CCGGGCCAGGCTGAGGAGAAAGG + Intronic
903974056 1:27137833-27137855 CAGGGGCACATTGGGGAGGGAGG - Intronic
904031319 1:27535147-27535169 CAGGTGCTGGGTGAGGAGGTGGG + Intronic
904263950 1:29307053-29307075 CAGGGGCAGATGGAGGTGGACGG - Intronic
904276392 1:29387468-29387490 CAAGGGCAGGTTGTGGTTGATGG + Intergenic
904286253 1:29454855-29454877 GAGGGGCAGCTTGGGGAGGTGGG - Intergenic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904384078 1:30130285-30130307 CAGGAGCTGGCTGAGGAGGGAGG + Intergenic
904392696 1:30196344-30196366 AAGGGGCTGGTTGATGACGATGG - Intergenic
904417987 1:30374525-30374547 GAGGGGCAGCTTGGGGAGGTGGG + Intergenic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904663310 1:32101200-32101222 CAGGGTAAGGCTGAGTAGGAAGG - Intronic
904756551 1:32771489-32771511 CAGGGGCAGGGGGTGGGGGAGGG - Exonic
905293302 1:36938177-36938199 CAGGGGCAGGAAGTGGTGGATGG + Intronic
905295693 1:36953182-36953204 CAGGGGCAGGGGGAGGGGCAAGG - Intronic
905572561 1:39017251-39017273 CAGGGCCTGGTGGAGGAGGCTGG + Intergenic
906136413 1:43503096-43503118 AAGGGGCAGGCTGAGAGGGAGGG - Intergenic
906210394 1:44009664-44009686 AAGGGGCAGGCTGAGATGGAGGG + Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907267253 1:53270354-53270376 TAGCTGCATGTTGAGGAGGAGGG + Intronic
907339785 1:53726703-53726725 CTGGGGGAGGTTGGGGAGGGAGG - Intronic
907477020 1:54712618-54712640 CAGGAGCAGGTTGTGGGGCAGGG + Intronic
907523600 1:55040551-55040573 CAGGGGCGGGGTGGGAAGGACGG + Intronic
907794504 1:57701542-57701564 CAGGGGTAGGGGGAGGAGGGAGG + Intronic
907830486 1:58060123-58060145 GAGCAGCAGGGTGAGGAGGAAGG + Intronic
907931040 1:59000469-59000491 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
908173943 1:61535335-61535357 TAGGGGCAGTTTTATGAGGAAGG + Intergenic
908328621 1:63048537-63048559 CATGGGCAGGGTGTGGAGGATGG + Intergenic
908658802 1:66416547-66416569 CAGAGGCTGGGTGAGGAGGTGGG - Intergenic
908745813 1:67375531-67375553 AGGTGGTAGGTTGAGGAGGAGGG + Intronic
910230248 1:84978893-84978915 CATCTGCAGGTTGAGGAGCAAGG + Intronic
910438258 1:87227353-87227375 GAGGTGCAGGTTCAGGATGAAGG + Intergenic
910979924 1:92949732-92949754 TAGGGGCAGGATGAAGTGGAAGG + Intronic
912415834 1:109507903-109507925 CAGGTGCAGGTCGAGGACGGTGG - Exonic
912933426 1:113983375-113983397 CAGACGTAGGTTGATGAGGATGG + Intergenic
912933470 1:113983573-113983595 CAGGGAGGGGTTGAGGGGGAAGG + Intergenic
913094101 1:115499935-115499957 CAGGGGCAGGTGGGGGTGGGTGG + Intergenic
913650908 1:120913174-120913196 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914082424 1:144421041-144421063 AAGGGGCAGGTAAAGGAGGTAGG + Intergenic
914525322 1:148459859-148459881 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
914598351 1:149175971-149175993 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914641078 1:149607269-149607291 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
915158525 1:153898963-153898985 CAGGGGCAACTTCAGGAGTAAGG - Intronic
915440354 1:155941942-155941964 CAGAGCCAGGTTGAAGACGAAGG - Exonic
915449329 1:155993830-155993852 CAGGGGCAGGAAGGGCAGGAAGG + Intronic
915586706 1:156847657-156847679 CAGGAGCAGGTTGGGGGGGTGGG + Intronic
915603154 1:156935175-156935197 CAGGGACAGGGTGGGGAAGAGGG + Exonic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915954918 1:160213489-160213511 AAGGGGGAGGAAGAGGAGGAAGG + Exonic
916491576 1:165306882-165306904 CAGGGGGAGGCGGAGGAGGGTGG - Intronic
916715017 1:167440924-167440946 CAGGAGCTGGTTGAGGTGGGAGG - Intronic
917162171 1:172069974-172069996 GAGGAGCAGGTGGAGGAGAAAGG + Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
918508599 1:185285141-185285163 CACGGGGAGGAAGAGGAGGAAGG - Intronic
919742794 1:200990837-200990859 CAGGGCCAGGGTGAGGAAGAGGG - Intronic
919911422 1:202113302-202113324 CTGGGGCAGGTGGAGAGGGATGG - Intergenic
920199708 1:204252076-204252098 CAGGGGCAGGGAGAGGGGGCAGG - Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920631439 1:207656672-207656694 CAGGAGCAAGGTGGGGAGGACGG + Intronic
920802694 1:209204317-209204339 CAGTGGCCGGTTGGAGAGGAAGG - Intergenic
920829311 1:209450600-209450622 GAGGAGCAGGCTGGGGAGGAAGG - Intergenic
921078743 1:211721813-211721835 TAAGGGAAGGATGAGGAGGAAGG - Intergenic
921159563 1:212463544-212463566 CTGGGTCAGGTAGAGGATGAGGG - Intergenic
922167222 1:223126334-223126356 CAGGGGCTGGGAGGGGAGGATGG + Intronic
922173694 1:223178436-223178458 CAAGGGGAGGCTGGGGAGGAGGG + Intergenic
922251866 1:223856582-223856604 CTGGGGCAGCTGGAGGAGCACGG + Intergenic
922427667 1:225514709-225514731 CAGGAGGTGGTGGAGGAGGAGGG + Exonic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922496741 1:226063050-226063072 CAGGGGCGCGGGGAGGAGGAGGG - Intronic
922535821 1:226379921-226379943 AAGGGCCAGGTCAAGGAGGAAGG - Exonic
922795907 1:228339647-228339669 CACAGGCAGGTGGTGGAGGAAGG - Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922873402 1:228921056-228921078 CAGGAGCAGGGAGAGGCGGAGGG + Intergenic
922985045 1:229859981-229860003 CAGGGGAAGATTGAGGTTGAGGG - Intergenic
923244661 1:232119842-232119864 GAGGAGCAGGCTGGGGAGGAAGG - Intergenic
923482391 1:234397342-234397364 GAGGGGGAGGATGGGGAGGAGGG + Intronic
923526226 1:234775000-234775022 CAGGGGCATGGTGGGGAAGAAGG - Intergenic
923672302 1:236051247-236051269 GAGGGGCAGGGGGAGGGGGAGGG - Intronic
923994040 1:239471549-239471571 CAGAGGCAGGATCAGGAAGAGGG + Intronic
924658788 1:245997425-245997447 CAGAAGCATGTTGAGGAGGAAGG - Intronic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1062982525 10:1737182-1737204 CAGGTGCAGGTGCAGGAGGGAGG - Exonic
1063115011 10:3067161-3067183 CAGGGGCAGCGTCCGGAGGAGGG - Intronic
1063121326 10:3106947-3106969 CAGGGGCAGGGTGAGGAGAGGGG - Intronic
1063227078 10:4025695-4025717 GAGGAGCAGGTTGAGGAGCGTGG - Intergenic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1063828953 10:9930723-9930745 CAGGGGCTGAGTCAGGAGGATGG + Intergenic
1064148686 10:12844880-12844902 GAGGGACAGCTTGAGGAGCAGGG - Intergenic
1064432492 10:15283226-15283248 CAGGGGCAAGCTGTGGAGGTGGG - Intronic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065889488 10:30109078-30109100 GAGGGGCAGCCTGAGGACGAGGG - Intronic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066492637 10:35908128-35908150 CAGGGGCAGTTTGCAGAGGCAGG + Intergenic
1066654688 10:37686931-37686953 CAGGGGCAGGATGAGGAATGGGG + Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067382439 10:45787403-45787425 CAGGTGCAGGATGAGGGGGGTGG - Intronic
1067527508 10:47047381-47047403 GAGGACCTGGTTGAGGAGGAAGG + Intergenic
1067890137 10:50127951-50127973 CAGGTGCAGGATGAGGGGGGTGG - Intronic
1068007688 10:51409609-51409631 CACGGGGAGGCTGAGGAGGGTGG + Intronic
1068080553 10:52313685-52313707 CGGGGGGAGGTGGGGGAGGAGGG + Intergenic
1068313911 10:55317109-55317131 CAGGGGCAGATAGGGGAGGAGGG + Intronic
1069001950 10:63276704-63276726 CACTGGGAGGTTGAGGAGGGTGG - Intronic
1069101668 10:64330104-64330126 CAGGGGCAGGGTGTGAGGGAAGG + Intergenic
1069548071 10:69342956-69342978 CCTGGGCAGCTTGAGGAGAACGG + Intronic
1069659242 10:70112671-70112693 GAGGGGCAGGGTGGGGAGGTGGG + Exonic
1069936612 10:71921869-71921891 CAGGGCCAGCTTGGGCAGGAGGG - Intergenic
1070156678 10:73839732-73839754 CAGGGGCAGGCTGAGGAGGTAGG + Intronic
1070567243 10:77613251-77613273 CTGGGGAAGGTTGTGGGGGAAGG - Intronic
1070589879 10:77794210-77794232 CAGGGGTAGGCTGTGGAGGGAGG + Intronic
1070752989 10:78974781-78974803 CAGAGCCAGGCTGGGGAGGAAGG - Intergenic
1070814122 10:79312537-79312559 GAGAGGCAGGTGGAGGGGGACGG + Intronic
1071432674 10:85618660-85618682 CAAGGGAAGGCTGAGGAGGAGGG - Intronic
1071517878 10:86311015-86311037 CATGGGCAGGAGGAAGAGGAGGG + Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071877808 10:89861482-89861504 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
1071978914 10:90983794-90983816 GAAGGGGAGGTTGATGAGGATGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072604819 10:96971587-96971609 CAGGGACAGGGTGCTGAGGAGGG + Intronic
1072611021 10:97017739-97017761 AGGGGGCAGCTTGAGGAGGCTGG + Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073046863 10:100644556-100644578 CAGTGGCAGATTAAGGATGAGGG + Intergenic
1073070997 10:100793234-100793256 CAGGGGCTGGTGGGGAAGGAGGG - Intronic
1073091139 10:100940791-100940813 CAGGGGCAGGGGGAGGGGCAGGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073540944 10:104315825-104315847 CTGGAGCAGGTGGCGGAGGAGGG - Exonic
1073632412 10:105161991-105162013 CAGGGGCAGGGGCGGGAGGAGGG - Intronic
1073740314 10:106399085-106399107 CACGGACAGGTGGAGGCGGATGG - Intergenic
1074150550 10:110755879-110755901 CAGGGCCAGGCTGAGGTGGTTGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074991815 10:118715684-118715706 TGGGGGTAGGTAGAGGAGGAGGG - Intronic
1075010544 10:118866121-118866143 CAGGGGGTGGTGGAGGAGGCAGG - Intergenic
1075086452 10:119417309-119417331 CTGAGGCAGGCTGGGGAGGAGGG - Intronic
1075216777 10:120543247-120543269 CAATGCCAGCTTGAGGAGGAAGG - Intronic
1075400152 10:122155210-122155232 GAGAGGCAGGTTGAGAAGGGCGG - Intronic
1075781030 10:125017235-125017257 AAGGTGCAGGCTGAGGAGCAGGG + Intronic
1076122195 10:127945109-127945131 CAGGGGAAGGGTGAGGAAGCTGG - Intronic
1076252348 10:128994583-128994605 CAGGGGGAGGTGGAGGAGAAAGG + Intergenic
1076404621 10:130203732-130203754 GAGGGGCAGGTGGAGGCGGGAGG - Intergenic
1076404629 10:130203751-130203773 GAGGGGCAGGTGGAGGCGGGAGG - Intergenic
1076404637 10:130203770-130203792 GAGGGGCAGGTGGAGGCGGGAGG - Intergenic
1076404645 10:130203789-130203811 CAGGGGCAGGTGGAGGCGGGAGG - Intergenic
1076407941 10:130225833-130225855 CAGGGGCAGGTCTAAGTGGAAGG - Intergenic
1076480949 10:130785014-130785036 CGGGAGCAGGTAGAGGAGGCAGG - Intergenic
1076526942 10:131117935-131117957 CAGGGCCAGGGTTGGGAGGAGGG - Intronic
1076601286 10:131658568-131658590 CTCGAGCAGGGTGAGGAGGAAGG + Intergenic
1076713787 10:132353157-132353179 CAGCAGGAGGTCGAGGAGGAAGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076854509 10:133109264-133109286 CGGGGGCTGGGAGAGGAGGAGGG - Intronic
1076963699 10:133787274-133787296 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1077016018 11:399479-399501 AGGGGGCAGGTGGAGGAGGGGGG - Intronic
1077023202 11:428728-428750 CAGGGTCAGGACGAGGATGACGG + Exonic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077407972 11:2391109-2391131 CAAGGCCAGGAGGAGGAGGAGGG + Intronic
1077481045 11:2814779-2814801 CAGAGGCAGATGGAGCAGGAGGG - Intronic
1077970588 11:7185001-7185023 CAAGGGAAGGGAGAGGAGGAGGG + Intergenic
1078094259 11:8286964-8286986 AGGGGGCAGGTGGAGGAGGGAGG - Intergenic
1078413152 11:11144021-11144043 CAGGGACAGGCTGAGCAGGGCGG - Intergenic
1078510032 11:11978175-11978197 CAGGAGAAGGTTGAGAAGGAAGG + Intronic
1078528485 11:12118634-12118656 CAGGGGCATGTTGTGGATGCAGG + Intronic
1079068258 11:17318088-17318110 CCCAGGCAGGTTGAGGGGGATGG - Intronic
1079244645 11:18743499-18743521 CAGGGCCAGGTTGAGGCTGCAGG - Intronic
1079249214 11:18774837-18774859 CATGGTCAGGTTGGTGAGGATGG + Intronic
1079278005 11:19059741-19059763 CAAAGGCAGGTAGAGAAGGATGG - Intronic
1080197302 11:29627397-29627419 CAGACTCAGGTTGAGGGGGATGG - Intergenic
1080763291 11:35273208-35273230 TAGGGGCAGGGTGTGGAAGAGGG + Intronic
1080874699 11:36265131-36265153 CAGTGACAGGATGAGGAAGAAGG - Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081669311 11:44934372-44934394 GAGGGCCAGATTGAGGAGGAGGG + Exonic
1081794616 11:45810953-45810975 CAGGGGCAGGAAGAGGATGCAGG - Exonic
1082045711 11:47724593-47724615 CAGGAGGAGGTGGTGGAGGAGGG + Exonic
1083341638 11:61962119-61962141 CTGGGGCATGGTGAGGAAGACGG + Intronic
1083423953 11:62573470-62573492 AGGGGACAGGTTGAAGAGGAGGG - Exonic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083490184 11:63009927-63009949 GAGGGCCAGGCTGAGGAGGGAGG + Intronic
1083874850 11:65516832-65516854 CACGTGCAGTTTGAGGAGGCTGG + Intergenic
1084029783 11:66474489-66474511 CATGGCCAGTTTGAGGAGCACGG - Intronic
1084031051 11:66480684-66480706 CCGGGGCAGGGCGAGGAGGCTGG + Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084085128 11:66851474-66851496 CAGTGGCAGGCTGTGGAAGAGGG + Intronic
1084371511 11:68748042-68748064 CAAGTGTAGGTGGAGGAGGAGGG - Intronic
1084858980 11:72005902-72005924 GAGGGGCAGGTGGAGCTGGATGG + Intronic
1084863575 11:72038631-72038653 CAGGGGGAGGGTGGGGAGGATGG - Intronic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085047966 11:73364251-73364273 CAGGGGCAGGGTGTGGGGGAGGG - Intronic
1085251032 11:75144239-75144261 CAGTGTCAGGCTGAGAAGGATGG + Intronic
1085304581 11:75477824-75477846 CAGGGGAAGGGTGAGGAGTCAGG + Intronic
1085514082 11:77102385-77102407 CAGGAGCAGGTGGAGAAGGCAGG - Intronic
1086224660 11:84493450-84493472 CAGGGGCTGGTTGGAGAGGATGG - Intronic
1086726555 11:90192447-90192469 AAGTGGCAGGTTGGGGAGGATGG + Exonic
1087642456 11:100769825-100769847 CAGGGGGAGGTGTAGGGGGATGG + Intronic
1088256932 11:107911771-107911793 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1088397308 11:109382782-109382804 CAGGGCCAGGTGGAGGATGCGGG + Intergenic
1088818235 11:113435649-113435671 TGGGGGCAAATTGAGGAGGAAGG - Intronic
1089054748 11:115576521-115576543 AAAGGGCTGGCTGAGGAGGAGGG - Intergenic
1089573216 11:119423332-119423354 GAGTGGCAGGTTGCGGCGGAAGG + Exonic
1089603857 11:119630390-119630412 CAGGGGCTGGTACAGGAAGAAGG + Intronic
1089643489 11:119863204-119863226 GAGAAGCAGGATGAGGAGGATGG + Intergenic
1089659555 11:119977195-119977217 AAGGGGCAGGTGGAGCAAGAGGG + Intergenic
1090033582 11:123228922-123228944 CAGGGTCAGGATGAGAAGGCAGG - Intergenic
1090679510 11:129038641-129038663 AAGTGGGAGGTTGAGGTGGAAGG + Intronic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091375392 12:21850-21872 CCGGGGCAGATAGAGGAAGATGG - Intergenic
1091457268 12:617394-617416 CAGGGGCAGGATTAGAAGGAAGG - Intronic
1091603089 12:1929800-1929822 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1091630778 12:2159115-2159137 GAGGGGCAGGTTGGGGAGGGGGG + Intronic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091729090 12:2866495-2866517 CAGGGAAAGGTTGTGGCGGATGG + Exonic
1091995403 12:4989004-4989026 AAGGGGCAGCTCGAGGAGGCTGG - Intergenic
1092030274 12:5278151-5278173 GAAGGGCAGGTAGAGCAGGAAGG + Intergenic
1092124490 12:6065799-6065821 CAGAGGCAGGATGAGGTGGGAGG + Intronic
1092301592 12:7255703-7255725 CATTGGTAGCTTGAGGAGGATGG - Intergenic
1092749922 12:11709228-11709250 CAGGGGTAGAATGAGGAAGAAGG - Intronic
1092840420 12:12535177-12535199 CCGAGGCTGGTGGAGGAGGATGG - Intronic
1093092290 12:14935666-14935688 TAAGGGCAGGGTGAAGAGGAGGG - Intronic
1093811655 12:23499437-23499459 CATGGGGAGGTTGAGGCGGGTGG + Intergenic
1094108310 12:26835730-26835752 TAGGGACAGGGTGAAGAGGAAGG - Intergenic
1094223185 12:28016826-28016848 GAGGGGTAGGTTTAGGAGAAAGG - Intergenic
1094546357 12:31408050-31408072 CATTGGGAGGTTGAGGCGGATGG + Intronic
1094607215 12:31959380-31959402 CAGGGGCGGGTCGAGGAGCCAGG - Intronic
1095533663 12:43221266-43221288 CAGGGGCAGATTTTGGAGGAAGG - Intergenic
1095752778 12:45729627-45729649 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1095818762 12:46453677-46453699 AAGGGCCATGTTGAGGAGGTAGG + Intergenic
1095889026 12:47218590-47218612 CAGGAGGAGGCTGAGGTGGAAGG - Intronic
1096079498 12:48824234-48824256 TGGGGGCAGGTGGAGCAGGAAGG - Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096217978 12:49808976-49808998 CAGGGGGAGGGAGAGAAGGAGGG + Intronic
1096677223 12:53232298-53232320 CAGGGGCAGGCAGGGGAGGGAGG - Intronic
1096683091 12:53269840-53269862 CTGCTGCAGGTTGGGGAGGAAGG + Exonic
1097030135 12:56083917-56083939 GAGGAGCAGGTTGAGGAAGGAGG - Intronic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097236801 12:57546213-57546235 ACGGGGCAGGTGGAGGAGAAAGG - Intronic
1099836188 12:87911450-87911472 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101193883 12:102362837-102362859 CATGTGCAAGTTGAGGAGCAAGG - Intergenic
1101210856 12:102534138-102534160 AAGGGGCTGGTTAAGGAGCAAGG - Intergenic
1101731353 12:107429000-107429022 CTAGGGCAGGTAGGGGAGGAAGG + Intronic
1101755509 12:107618072-107618094 CAGGGGCAGGCTGGGGAAGCAGG - Intronic
1102994877 12:117341372-117341394 CTAGGGCGGGATGAGGAGGACGG + Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103056357 12:117824248-117824270 AAGGGGCAGGGGGAGGGGGAGGG + Intronic
1103372304 12:120428780-120428802 CAGTGGGAGGTTGAGGTGGGAGG - Intergenic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103615534 12:122149382-122149404 CAGAGGCAGCTGGAGCAGGATGG - Intergenic
1103722653 12:122982814-122982836 CAGGGGCAGGGGGTGGAGGTTGG + Exonic
1104016764 12:124966885-124966907 GAGGGGCAGGTTGGGGAGAAAGG + Intronic
1104276530 12:127333608-127333630 CAGGGGCAGGGTGGGCAGAACGG + Intergenic
1104781279 12:131422101-131422123 AGGGGACAGGTGGAGGAGGAGGG - Intergenic
1104845787 12:131846083-131846105 CAGGGGCAGGTGGGGGTGGCAGG + Intronic
1104949200 12:132431469-132431491 CACGGGGGGGTTGAGGGGGAAGG - Intergenic
1105241181 13:18610544-18610566 CACAGGCAGCTTGAGGAGGATGG + Intergenic
1105277330 13:18943717-18943739 CAGGGGGAGGTTGAGGTAGCCGG - Intergenic
1105834159 13:24193582-24193604 AAGGGGCAGGAACAGGAGGAAGG + Intronic
1106009553 13:25806154-25806176 CAGGGGTAAGTTGAGGAGGCGGG + Intronic
1106679960 13:31999451-31999473 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1107718556 13:43224885-43224907 CAGGAGCAGGGAGAAGAGGAAGG - Intronic
1107987637 13:45788948-45788970 AATGAGCAGGTTGAGGTGGAGGG + Intronic
1108082341 13:46749373-46749395 CAGGGGCTGGGTGGGGAGGTGGG + Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108512902 13:51171531-51171553 CAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1108696821 13:52909563-52909585 CAGGGGCAGGTTAGGGGAGATGG + Intergenic
1109716837 13:66230422-66230444 CAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1110867456 13:80411938-80411960 CAAGAGCAGCTTGAGCAGGATGG - Intergenic
1110978390 13:81867803-81867825 GAGGGGCAGCCTGGGGAGGAGGG - Intergenic
1111073315 13:83199161-83199183 GAGGAGAAGGTTGAAGAGGAGGG - Intergenic
1111743505 13:92234780-92234802 CTGGTGCAGGTGGAAGAGGAGGG + Intronic
1111888162 13:94049294-94049316 CAGTGGGGGGTTGGGGAGGAGGG - Intronic
1111972055 13:94926768-94926790 GATGGGCAGGATGAGTAGGAAGG - Intergenic
1112011746 13:95299361-95299383 GAGGGGCACGTGGAGGAGGAAGG - Intronic
1112558750 13:100493156-100493178 CAGGGGCAGGTGTAGGAGCTGGG - Intronic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1113520675 13:110938273-110938295 AAGGGCCAGGTCAAGGAGGAAGG + Intergenic
1113661111 13:112106925-112106947 TAGGGGTAGGAAGAGGAGGAGGG + Intergenic
1113692788 13:112323632-112323654 CAGGGGCAGGAAGCGGAGGGAGG - Intergenic
1113868264 13:113543174-113543196 GAGGGGCAGGGGGAGGAGGTGGG - Intronic
1113868309 13:113543295-113543317 CGGGGGCAGGGGGAGGAGGTGGG - Intronic
1113868377 13:113543452-113543474 CATGGGCAGGGGGAGGAGGTGGG - Intronic
1114246067 14:20915175-20915197 CATTGGCAGCTTGATGAGGATGG - Intergenic
1114318050 14:21525226-21525248 GAGGGGGTGGTGGAGGAGGAGGG + Exonic
1114398060 14:22384499-22384521 CAGTGGTAGGTAGAGGAAGAAGG + Intergenic
1115882356 14:37933714-37933736 CAGAGGCAAATCGAGGAGGAAGG - Intronic
1116291846 14:43053380-43053402 CATCTGCAGGTTGAGGAGCAAGG + Intergenic
1117222994 14:53625239-53625261 CAAGGTCAGGTTGAGGGGAAGGG - Intergenic
1117461472 14:55949447-55949469 CAGGGGCAGGGTGGTGGGGAAGG - Intergenic
1118247532 14:64125840-64125862 CAGGAGCAGGCTGCAGAGGAGGG - Intronic
1119391630 14:74295000-74295022 CAGGGGGAGGTAGAGGGAGAGGG + Intronic
1119493794 14:75061568-75061590 GAGGGGCAGGTAGAGAAAGATGG + Intronic
1119500812 14:75126273-75126295 CAAGGTCGGGGTGAGGAGGAGGG - Intronic
1119806454 14:77485371-77485393 CAGGAGCAGGCTGAGGGGAAAGG - Intronic
1119886992 14:78151664-78151686 CAGGGTGTGGTTCAGGAGGAAGG - Intergenic
1121656855 14:95603431-95603453 CAGGGGCAGGTTGAGTTGAGGGG + Intergenic
1122620765 14:103056713-103056735 AAGGGGCAGGATGAGGGGGCGGG + Intronic
1123124994 14:105940169-105940191 CACGGGCAGGAAGATGAGGAAGG + Intergenic
1123125326 14:105941828-105941850 CTGGTGCAGGATGAGGAGGTGGG + Intergenic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123443016 15:20304015-20304037 CAGGGCCAGGGTCAGGAGCAAGG - Intergenic
1123490174 15:20774603-20774625 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123546675 15:21343690-21343712 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1124607712 15:31183944-31183966 GAGGGGGAGGGAGAGGAGGAGGG - Intergenic
1124694521 15:31852954-31852976 CAGGGACAGGCTGAGGAGGTGGG + Intronic
1124859820 15:33428201-33428223 CAGGGACAGGTAGAAGAAGAAGG - Intronic
1124879554 15:33628586-33628608 CAGGGCCAGGTTAGGGTGGAGGG + Intronic
1125542612 15:40478946-40478968 CAGGGGCAGCCTGAGAGGGAAGG + Intergenic
1125609533 15:40961112-40961134 CCAGGGCAGGCTGAGGAGGAAGG - Intergenic
1125787504 15:42333867-42333889 CAGGGGCTGGTGGAGGTGGGAGG + Intronic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126688489 15:51268253-51268275 CAGGGGATGGGTGTGGAGGAAGG - Intronic
1127637775 15:60888064-60888086 AAAGGGGAGGTTGAGGAGCAGGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1127960648 15:63887927-63887949 CAGGGGTAGGGTCAGGAGGAAGG - Intergenic
1127980631 15:64032519-64032541 CAGGGGCAGGTTGGAGAGGCTGG - Intronic
1128046557 15:64623076-64623098 CAGAAGCAGGTTGAGAAGGGAGG - Intronic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128249104 15:66152376-66152398 GAGAGGAAGGGTGAGGAGGAGGG - Intronic
1128390850 15:67181473-67181495 CAGGGGCAGGGTGGGGGGGCGGG - Intronic
1128550680 15:68596265-68596287 CAGGGACAGGCCCAGGAGGATGG + Intronic
1128579297 15:68797746-68797768 CAGGGGCAGGTTGCCTGGGAGGG - Intronic
1128744417 15:70103509-70103531 CAGGTGCGGGGTGAGGGGGAAGG - Intergenic
1128944689 15:71812386-71812408 CAGGGGGAGGAAGAGGAGTATGG - Exonic
1129107448 15:73319498-73319520 CCAGGGCTGGCTGAGGAGGAGGG - Intergenic
1129207121 15:74043957-74043979 CTGGGGCCGGTAGTGGAGGAGGG + Intronic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129253492 15:74321091-74321113 CAGGGACAAGTCGGGGAGGATGG - Intronic
1129449073 15:75639809-75639831 CATGCGCAGCTTGAGGAGCACGG + Exonic
1129465403 15:75721866-75721888 AAGGGGCTGGATGAGGAGGGTGG + Intergenic
1129601755 15:77003192-77003214 CAGGCTCTGGGTGAGGAGGAAGG - Intronic
1129644565 15:77419193-77419215 CAGAGGCAGGCGGGGGAGGAGGG + Intronic
1129672837 15:77616614-77616636 CAGGTGCAGGGGGAGGAGGGAGG - Intronic
1129771560 15:78206365-78206387 CAGGGACAGGCTGAGGAAGGAGG - Intronic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1130868541 15:87952496-87952518 CCGGGGCAGGGAGAGGAGGTGGG - Intronic
1130959901 15:88652557-88652579 GAGGGGGAGGGGGAGGAGGAAGG - Intronic
1131017853 15:89072506-89072528 AAGGGGAAGGATGAGCAGGAGGG + Intergenic
1131017865 15:89072536-89072558 AAGGGGAAGGATGAGCAGGAGGG + Intergenic
1131164768 15:90134436-90134458 GAGGAGCAGTTTGGGGAGGAGGG - Intergenic
1131182970 15:90253133-90253155 CGAGGGCAGGTTGAAGAGGGAGG - Intronic
1131317613 15:91353820-91353842 AAAGGGCAGGTGAAGGAGGAAGG - Intergenic
1132014263 15:98301844-98301866 GAGGAGGAGGATGAGGAGGAGGG + Intergenic
1132240395 15:100253355-100253377 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240403 15:100253373-100253395 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240411 15:100253391-100253413 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240419 15:100253409-100253431 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240427 15:100253427-100253449 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240435 15:100253445-100253467 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240443 15:100253463-100253485 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132354912 15:101164094-101164116 TAGGGGCAGTTTAGGGAGGATGG - Intergenic
1202955006 15_KI270727v1_random:70905-70927 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1132481674 16:169393-169415 CTGGGGCAGGGAGGGGAGGAGGG - Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132599624 16:767866-767888 GAGGGGCGCGTGGAGGAGGAGGG + Intronic
1132749291 16:1450066-1450088 CAGAGGCAGGCAGAGAAGGAAGG + Intronic
1132839402 16:1971719-1971741 CAGGGGCAGGGTCAGGTTGACGG + Intergenic
1132957081 16:2600035-2600057 AAGGGGCTGGGTGAGGAGAAAGG - Exonic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133020147 16:2963565-2963587 GCGGGGCAGGGGGAGGAGGAGGG + Intergenic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133571219 16:7042267-7042289 GAGGCGCAGATTGGGGAGGAGGG + Intronic
1133643065 16:7736593-7736615 CATGTGCAAGTTGAGGAGCAAGG + Intergenic
1133854060 16:9533187-9533209 CACGGGCGGGGTGAGAAGGACGG - Intergenic
1134213929 16:12301358-12301380 TAGGGGCAGGCTGAGGGGGCTGG - Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134449268 16:14353882-14353904 CAGGGGGAGGAAGAAGAGGAGGG + Intergenic
1135155177 16:20046687-20046709 CAGGGGGAGATTGAGGAGAACGG + Intronic
1135870298 16:26143597-26143619 CCGGGGCAGGTTGTGGGGGTGGG + Intergenic
1136228565 16:28874098-28874120 CCGAGGCAGGGTGAGGGGGAAGG + Exonic
1136251638 16:29009372-29009394 GAGGGGCAGGGAGAGGAGGAGGG - Intergenic
1136362688 16:29790943-29790965 CAGGGGCGGGGAGAGGGGGACGG + Intronic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1137257526 16:46789453-46789475 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1137966119 16:52935612-52935634 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1138267754 16:55672028-55672050 CCAGGGCAGGTTGAGGGTGAAGG - Exonic
1138546355 16:57722106-57722128 GAGGGGCAGGTAGAGAAGGCAGG + Intronic
1138680158 16:58678371-58678393 GAGGGGCAGGATGAAGAGGAAGG + Exonic
1139165756 16:64563332-64563354 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1139334413 16:66221198-66221220 CAGGTGCAGGCTGAGGTGGGAGG - Intergenic
1139394571 16:66630298-66630320 GAGGGGGAGGGTGAGGGGGAGGG - Intronic
1139562157 16:67749959-67749981 GAGGGGCAGGGGTAGGAGGAGGG - Intronic
1139649266 16:68354057-68354079 GAGGGGCAGGGTGAGGAGCATGG + Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140856522 16:78982614-78982636 CAGGAGCAGGCAGAGAAGGAGGG + Intronic
1141372444 16:83500487-83500509 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1141441674 16:84033366-84033388 CAGGGGCAGGATGACCAGCACGG + Exonic
1141470121 16:84232413-84232435 CAGGGGCTGGTGGGAGAGGAAGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141570222 16:84929596-84929618 GAGGGGCATGGAGAGGAGGAAGG + Intergenic
1141608862 16:85170212-85170234 CAGGGGCGCGCGGAGGAGGAGGG + Intergenic
1141712764 16:85709667-85709689 CAGGGAGAGGGTGAGGAGGTGGG - Intronic
1141792299 16:86244890-86244912 GAGGGGCAGGTGGAGGTAGACGG + Intergenic
1141859942 16:86709689-86709711 CAGGGACTGGATGCGGAGGACGG + Intergenic
1141888761 16:86912076-86912098 GAGGGGCAGGGTGATGATGATGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142256281 16:89015276-89015298 CAGGGGCTGGATGAGGAGGGGGG + Intergenic
1142278666 16:89136711-89136733 CAGAGGCAGGTGGGGGAGGCAGG - Intronic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1143615539 17:8047152-8047174 GAGGCTCACGTTGAGGAGGAGGG + Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144396866 17:14852823-14852845 CAGGAGCAAGTGGAGGAGGGGGG + Intergenic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1144581202 17:16460512-16460534 GAGGGGCAGGTTGGGGAGGGAGG + Intronic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144721911 17:17476942-17476964 CAGGGGCGGGGTGTGGAGGAAGG - Intergenic
1144812064 17:18006850-18006872 CAGGGGCAGGGAGTCGAGGAAGG + Intronic
1144958035 17:19029456-19029478 CAGGGGCTGGCTCAGCAGGAGGG - Intronic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144977123 17:19145064-19145086 CAGGGGCTGGCTCAGCAGGAGGG + Intronic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145961390 17:28888293-28888315 CAGCGGCAGGTAGAGCTGGATGG + Intronic
1146300030 17:31680653-31680675 CAGGAGGAGGATGAGGTGGAAGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146930105 17:36770892-36770914 GAGGGGAAGGTTGAAGGGGAAGG - Intergenic
1147186094 17:38713765-38713787 CTGGGGCGAGTGGAGGAGGATGG - Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147331082 17:39699999-39700021 AAGGAGGAGGTGGAGGAGGAGGG + Intronic
1147352374 17:39859986-39860008 CTTGGGAAGGTTGAGGCGGAAGG + Intronic
1147498777 17:40942374-40942396 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1147892242 17:43725564-43725586 CAGGGCCTGGCTCAGGAGGAGGG - Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148458577 17:47824385-47824407 CAGGGGCAGGCTGGGGAGCTTGG + Exonic
1148460513 17:47836846-47836868 CAGGGGCAGGTCGGTGAGGGTGG - Exonic
1148614671 17:48991221-48991243 CAGGGGCAGGGGGAGGGGCAGGG + Intergenic
1148667247 17:49383879-49383901 CAGGTGGAGGTAGAGGTGGAAGG - Intronic
1148670281 17:49404995-49405017 CTGGGGCAGCTGGAGGAGCACGG + Exonic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149107099 17:52982639-52982661 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1149195171 17:54110792-54110814 GAGGGGGAGGTGGAGGGGGAGGG + Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149655312 17:58306736-58306758 CAGGGTCAGGTGGAGTTGGAAGG + Intronic
1150293063 17:63992972-63992994 CAGGGGCAGAGTCAGGAGGGAGG + Intergenic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151009816 17:70481788-70481810 CAGGGTTGGGTTGGGGAGGAGGG - Intergenic
1151386164 17:73756680-73756702 CAGGGGCTGGCTGTGGAAGAGGG + Intergenic
1151574157 17:74943239-74943261 CAGGGGCTGGTGGAGGTGGTGGG - Intronic
1151745625 17:76010257-76010279 AAGGCCCAGGTGGAGGAGGAGGG - Exonic
1151756956 17:76080502-76080524 CAGGGGCAGGGTGCGGGGCAAGG + Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152059775 17:78063375-78063397 GAGGAGCAGGCTGAGGAGGAAGG + Intronic
1152234840 17:79133154-79133176 CAGGAGCAGGGTGGGGAGCAAGG + Intronic
1152275884 17:79356893-79356915 CAGGAGCTGGCTGAGGGGGACGG - Intronic
1152293144 17:79452182-79452204 CATGGGATGTTTGAGGAGGAAGG + Intronic
1152345914 17:79751595-79751617 CAGGGGCTGGGGGAGGAGGGTGG + Intergenic
1152388406 17:79988888-79988910 CAGGTGCGGGTTGGGGAGGGTGG - Intronic
1152451449 17:80383777-80383799 CCGGGGCAGGTGGGGCAGGAAGG - Exonic
1152497486 17:80683950-80683972 GAGCGGCATGTTGAGGATGAGGG - Intronic
1152572982 17:81128598-81128620 CAGGGGCCGGGTGAGGAAGCTGG - Intronic
1152691494 17:81720186-81720208 CAGGGGCCTGCTGCGGAGGACGG - Exonic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153512260 18:5868871-5868893 CAGGGGTGGGTGGAGGAGGCAGG - Intergenic
1153574643 18:6508399-6508421 CAGGGGCAGGGTGCTGAGGCAGG - Intergenic
1153795261 18:8616141-8616163 CAGGGGAAGGTCGAGCAGGATGG - Intronic
1153820468 18:8827250-8827272 CATGGGCAGGGAGAGGAGGAAGG + Intronic
1154447777 18:14449357-14449379 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1155068223 18:22287317-22287339 CAGGGGCAGGGAGAGGAAGGTGG - Intergenic
1155362531 18:25016679-25016701 CAGGGGAAGGTGGTGGAGAAGGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156858608 18:41811945-41811967 CAGGGGGATGTTGAGAAGGGTGG + Intergenic
1157127670 18:44972418-44972440 CATTGGTAGCTTGAGGAGGATGG + Intronic
1157192051 18:45589828-45589850 CTGGGGCAGGGAGGGGAGGAGGG + Intronic
1157199946 18:45651600-45651622 CAGGAGCAGGGTGTGGAGGCCGG + Intronic
1157476166 18:48024954-48024976 CTTTGGGAGGTTGAGGAGGAAGG - Intergenic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1157784511 18:50469738-50469760 CATGCGCAGGTGGAGGAGGCTGG + Intergenic
1157906492 18:51574117-51574139 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1157911754 18:51623131-51623153 CAGGGGCTGGAAGATGAGGAAGG + Intergenic
1158423153 18:57313609-57313631 CAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1158510528 18:58086410-58086432 GACTGGCAGGTTGAGGAGCAGGG + Intronic
1158516653 18:58136279-58136301 CAGTGGCAGGATGCGGAGCAGGG - Intronic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159628720 18:70724704-70724726 CAGGGTCAGGTTGAAGACGAGGG + Intergenic
1159720295 18:71881543-71881565 CTGGGGGAGGATGAGGAGGGAGG - Intergenic
1159984759 18:74828926-74828948 GAGGGGGAGGTAGAGGAGGACGG - Intronic
1160143650 18:76347559-76347581 GAGGAGCAGGTGCAGGAGGAGGG - Intergenic
1160208645 18:76858637-76858659 CGAGTGCAGGTGGAGGAGGAAGG + Intronic
1160208659 18:76858681-76858703 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208685 18:76858769-76858791 CGGGTGCAGGTGGAGGAGAAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208713 18:76858857-76858879 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208726 18:76858901-76858923 CGGGTGCAGGTGGAGGAGAAAGG + Intronic
1160208741 18:76858945-76858967 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208755 18:76858989-76859011 CGGGTGCAGGTGGAGGAGAAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208783 18:76859077-76859099 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208797 18:76859121-76859143 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208812 18:76859165-76859187 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208824 18:76859209-76859231 CAGGTGCAGGTGGAGGAGAAAGG + Intronic
1160208839 18:76859253-76859275 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160755440 19:754801-754823 GAGCTGCAGGTAGAGGAGGAGGG + Intronic
1160819764 19:1052490-1052512 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
1160819783 19:1052533-1052555 GAGGGGAAGGGAGAGGAGGAGGG + Intronic
1160900244 19:1424338-1424360 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1160940971 19:1620339-1620361 CGGGGGCAGGTACAGGAGGAGGG - Intronic
1160965284 19:1744656-1744678 GAGGGGGAGGAAGAGGAGGAGGG - Intergenic
1160965748 19:1746234-1746256 AAGAGGGAGGGTGAGGAGGAGGG + Intergenic
1160965793 19:1746348-1746370 AAGGGGGAGGATGGGGAGGAGGG + Intergenic
1161012575 19:1967738-1967760 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012596 19:1967799-1967821 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012657 19:1967975-1967997 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012699 19:1968090-1968112 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012735 19:1968198-1968220 CTGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012753 19:1968252-1968274 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161082965 19:2320560-2320582 CATGGGGAGGTTGAGGCGGGTGG + Intronic
1161161283 19:2763029-2763051 CAGGGGCTGCTTGTGGATGACGG - Intronic
1161214639 19:3087865-3087887 CAGAGACTGGTTGAGGAGGGAGG + Intergenic
1161241267 19:3225096-3225118 CAGAGGCAGGCAGAGGAGGGAGG - Intronic
1161319470 19:3634291-3634313 CAGGGGGAGCTTGAGGGGGTGGG - Intronic
1161475111 19:4480380-4480402 CAGGGGCAGGCCCTGGAGGATGG + Intronic
1161486127 19:4536836-4536858 CAGGGGCAGGATGGGGCTGAAGG - Exonic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161852562 19:6745181-6745203 CGGGGGCAGGGTGGGGAGGTGGG + Intronic
1161964403 19:7540324-7540346 CAGGGGCTGCTGCAGGAGGATGG + Intronic
1162038146 19:7953485-7953507 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1162953883 19:14088004-14088026 CAGGGGCAGACTGAGAAGGGGGG + Exonic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163630656 19:18416628-18416650 CCGGGGCAGGGTGAAGAAGAGGG - Intergenic
1163769257 19:19180723-19180745 CAGGATCAGGCTGAGGAGGGCGG + Exonic
1163815623 19:19462944-19462966 CAGGGGCAGAGTGGGGAGCATGG + Intronic
1163827814 19:19533447-19533469 AGGGGGCAGGAGGAGGAGGAAGG - Intronic
1163827843 19:19533547-19533569 CAGGAGGAGGGGGAGGAGGAGGG - Intronic
1164210531 19:23093800-23093822 CAGGGGCATGGTGGGAAGGAAGG + Intronic
1164477748 19:28588206-28588228 CAGGGGCAGGGAGAGCTGGAAGG - Intergenic
1164555168 19:29245783-29245805 CAGTGGGAGGTAGAAGAGGAGGG + Intergenic
1164591931 19:29512145-29512167 AAGAGGGAGGGTGAGGAGGAAGG + Intergenic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1164868744 19:31626014-31626036 GAGGGGGAGGATGAGGAGGAAGG - Intergenic
1165067469 19:33237406-33237428 CAGGGGCAGGTGGAGGACGAGGG - Intergenic
1165113263 19:33514157-33514179 CAGGGGCAGGGTGTGCAGGAGGG + Intronic
1165160229 19:33811609-33811631 CAGGGGCAGAGTGAGCTGGAGGG + Intronic
1165763521 19:38336317-38336339 AAGGGGCAGGGCGAGGAGGAGGG + Intronic
1165792930 19:38502798-38502820 CAGGGGCAGGGGGAGGAGCAGGG + Intronic
1165939870 19:39409720-39409742 GAGGGGCCGGGTGGGGAGGACGG + Intergenic
1166085631 19:40472806-40472828 CTGGGGTGGGATGAGGAGGAGGG + Intronic
1166141726 19:40808766-40808788 CAGGTGCAGGCAGAGGAGGAAGG - Intronic
1166259030 19:41625317-41625339 CAGGGTCAGGTTCATGGGGAGGG + Intronic
1166270450 19:41710315-41710337 CAGGGTCAGGTTTACGGGGAGGG - Intronic
1166366108 19:42279310-42279332 CTGGGGCAGGTGGGTGAGGAAGG + Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166755090 19:45185716-45185738 CAGGGCCAGAATGAGGAGCAGGG + Intronic
1166820272 19:45574983-45575005 CAGGTGCAGGTGGAGGTGGCTGG - Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167130514 19:47582246-47582268 CAAGGGGAGGATGAAGAGGAGGG - Intergenic
1167153961 19:47726783-47726805 TTGGGGCAGGCTAAGGAGGAAGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167253807 19:48415507-48415529 CAGGGGCGGGGTTTGGAGGAGGG + Intronic
1167268273 19:48493953-48493975 CCGGGGCCGGCGGAGGAGGACGG - Exonic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
1167382409 19:49146252-49146274 CAGGGGCAGGGCTCGGAGGAGGG - Intronic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168326616 19:55541818-55541840 CAGGTTGAGGTTGAGGATGATGG - Intronic
1168508979 19:56959450-56959472 CCGGGGGAGGCTGAGGATGAGGG + Intergenic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
1202712307 1_KI270714v1_random:25226-25248 TAGGGGCAGGTTGAGGGGTGGGG - Intergenic
924980013 2:210890-210912 AAGGGGAAGGTGGAGCAGGAGGG - Intergenic
925622564 2:5808065-5808087 CAGGGGCAGGCAGAGTTGGATGG - Intergenic
926419858 2:12685826-12685848 AAGGGCCAGGTTGGAGAGGAGGG - Intergenic
926679934 2:15655308-15655330 CAAAGTCAGGTTGAGGAGGTTGG - Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926799104 2:16643336-16643358 CAGGGGGAGCTTGAGGAGCCAGG + Intronic
926889434 2:17626556-17626578 CAGGGGCAGGGTGGGTGGGAAGG - Intronic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927139149 2:20118066-20118088 CAGGAGCAGCTGGAGGAGCAGGG + Intergenic
927515759 2:23670782-23670804 CCGGGCCAGGTTGGGCAGGAGGG + Intronic
927651061 2:24914053-24914075 CCTGGGCTGGGTGAGGAGGAAGG - Intronic
927709168 2:25314492-25314514 CAGGGGCTGGTTGGGGTGGGAGG - Intronic
927908795 2:26881587-26881609 CAGGAGCAGGCACAGGAGGAAGG + Intronic
928261394 2:29770140-29770162 CAGGCACAGTTAGAGGAGGAGGG + Intronic
928349797 2:30539356-30539378 CAGGAGGAGGGTGAGGTGGAAGG - Intronic
928395346 2:30939457-30939479 CAGGAGCAGGCTGATGAGGCTGG + Intronic
928399777 2:30969408-30969430 CAGGGGCAAGTTGGGGAGGGAGG + Intronic
928683581 2:33726988-33727010 CGGGGGCAGGATGAAGAGGTTGG + Intergenic
928706249 2:33952765-33952787 CGGGGGCAGGGTGTGGAGGGTGG + Intergenic
929083254 2:38142422-38142444 CAGGGGCAGGGTGTGGTGGGGGG - Intergenic
929518074 2:42622406-42622428 TAGGGGGAGGTAGAGGGGGAGGG + Intronic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
932115455 2:69042732-69042754 CAGGTGAAGGGTGGGGAGGAGGG - Intronic
932406731 2:71517981-71518003 GATGGCCAGGATGAGGAGGAGGG - Intronic
932671105 2:73738530-73738552 CAGGGGCAGGGGGAAGAGGTGGG + Intergenic
932788476 2:74630486-74630508 CTGGGGCCCGTTGAGGAGGCGGG - Intronic
932796393 2:74699659-74699681 CAAGGGTAGGTGGAGGAAGATGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
934059959 2:88284281-88284303 CAGGGCCAGGCGGAGGCGGAGGG - Intergenic
934661449 2:96145589-96145611 GGGGGGGAGGTTGAGGGGGAAGG + Intergenic
935128985 2:100247375-100247397 CTCAGGCAGCTTGAGGAGGATGG - Intergenic
935366166 2:102293115-102293137 CAGGTGGAGGGTGGGGAGGAGGG + Intergenic
936355389 2:111745818-111745840 CTGGGGCAGATTGCGGTGGAGGG - Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937252236 2:120532270-120532292 AGGGGGAAGGCTGAGGAGGAGGG - Intergenic
937311740 2:120907010-120907032 CAGGGACAGGTTGGTGTGGAGGG - Intronic
937325153 2:120985845-120985867 CAGGGGCAGGTTGTGGGAAAGGG - Intronic
937338649 2:121077113-121077135 CAGGTGCAGGTTGTGCAGGGAGG - Intergenic
937735626 2:125284598-125284620 CACTGGCAGCTTGAGGGGGAAGG - Intergenic
937912029 2:127080419-127080441 CAGGAGTTGGGTGAGGAGGAGGG + Intronic
937953750 2:127408005-127408027 GAGGGGCAGGGGGAAGAGGAGGG - Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938800540 2:134759546-134759568 AAGGGGGAGGGGGAGGAGGAAGG + Intergenic
938894812 2:135739466-135739488 CATGTGGAGGTTGAGGAAGAAGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939983219 2:148805651-148805673 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
940485022 2:154287400-154287422 CTGGGGCAGCTGGAGGAGCATGG - Intronic
942020145 2:171859662-171859684 CAGGGGCTGGTTGGAGTGGAAGG + Intronic
942116201 2:172731441-172731463 CAGCTGTAGGTTGGGGAGGAGGG + Intergenic
942493320 2:176511587-176511609 CATCGGCAGGCTGAGGAGCAAGG + Intergenic
942655874 2:178213491-178213513 AAAGGGCAGGGTGATGAGGATGG - Intronic
942744823 2:179220183-179220205 AAGGGACAGAGTGAGGAGGATGG - Intronic
943890257 2:193277272-193277294 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
944155556 2:196603835-196603857 CTGGGGGAGGTTGGAGAGGAGGG + Intergenic
944651917 2:201838795-201838817 GAGGGGCAGGTTGATGGGAAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945514059 2:210740249-210740271 CAGCTGCAGGTTCAGTAGGACGG + Intergenic
945697582 2:213127242-213127264 TAGTGGCAGGTTGTGGAGAAGGG + Intronic
945923243 2:215777772-215777794 TAGGGGTAGGGTGAGGATGAAGG + Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946189813 2:218002280-218002302 CAGGGGAGGGCTGTGGAGGAAGG + Intronic
946308281 2:218868440-218868462 GAGGGCAGGGTTGAGGAGGAGGG + Intronic
946371854 2:219285925-219285947 CAGCGGCAAGCTGTGGAGGATGG - Exonic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946463370 2:219889918-219889940 CTGGGGCAAGATGAGGAAGAGGG - Intergenic
947446501 2:230167667-230167689 CAGGGACAGATTCAGAAGGAGGG - Intronic
948330499 2:237160735-237160757 CAGGCGCAGGTTGCTGAGGCTGG + Intergenic
948693910 2:239723112-239723134 GAGGGGCAGGTGGAGAAGGCGGG + Intergenic
948764510 2:240212531-240212553 CAAGTGCAGGTTGTGGTGGATGG - Intergenic
948809183 2:240466241-240466263 AAGGGCCAGGAAGAGGAGGAGGG - Exonic
948877503 2:240837507-240837529 CAGGGACAGGCTGAGGAGGTAGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
949077033 2:242066761-242066783 CAGGGGCAGTTTGCGGAGTGAGG - Intergenic
1168779052 20:473273-473295 CATTGGCAGGTGGGGGAGGAGGG + Intergenic
1168804007 20:662337-662359 CAGGGGAAGGTTCAGGAAGGTGG + Exonic
1168810502 20:701607-701629 CAGCTGTAGGGTGAGGAGGATGG - Intergenic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169043524 20:2516807-2516829 GAGGGTCAGGTTGAGGATAAAGG + Intronic
1169192973 20:3669510-3669532 CAGGGGGAGGTGGAGAGGGAAGG - Intronic
1169592121 20:7156223-7156245 TAGGTGCAGGGTGAGGAGGCAGG + Intergenic
1170311225 20:14994463-14994485 CGGGAGCAGGTTGAAGAGTAGGG + Intronic
1170606905 20:17881647-17881669 CAGGGAGAGGTTGGGGAGGTGGG + Intergenic
1171036873 20:21720189-21720211 CTTTGGGAGGTTGAGGAGGAAGG + Intergenic
1171178218 20:23070965-23070987 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1171262720 20:23747973-23747995 CAGAGCCTGGGTGAGGAGGATGG + Intronic
1171272347 20:23826781-23826803 CAGGGGCAGGTCATGGAGGGGGG - Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172689003 20:36777798-36777820 AGGGGCCAGGATGAGGAGGAAGG + Exonic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172834013 20:37861226-37861248 CATGGGGTGGGTGAGGAGGAGGG - Intronic
1173002086 20:39111749-39111771 GAGGGGCAGGGGGAGGAAGAGGG + Intergenic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173320910 20:41986125-41986147 CAGGTCCAGGGTGAGGATGAAGG - Intergenic
1173750091 20:45469816-45469838 CAGCAGCAGGCTGAGGAGGAGGG - Exonic
1173798424 20:45878909-45878931 CAGGGGCTGGGGGAGGAAGAGGG - Exonic
1174023228 20:47548602-47548624 CAGTGGCAGTTTGAGAAGAAGGG + Intronic
1174047644 20:47744810-47744832 ATGGGGCAGGCTGAGGATGAAGG + Intronic
1174141043 20:48413759-48413781 CAGTGGCAGGTGGGGGAGGTAGG + Intergenic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174671425 20:52311344-52311366 CAGGAGCAGGTTAAGGAAGTCGG + Intergenic
1174697655 20:52576610-52576632 CATGGGCAGGTTGGGGAGATGGG - Intergenic
1175164360 20:57032867-57032889 CAGGGGCTGGCTGAGCTGGATGG + Intergenic
1175855108 20:62116921-62116943 CAGGAGCTGGATGGGGAGGATGG - Intergenic
1175901510 20:62361666-62361688 GTGGGGCAGGTGGAGGAGGCTGG - Intronic
1175942949 20:62546293-62546315 CGGGTGCAGGAGGAGGAGGATGG + Intergenic
1176256989 20:64158071-64158093 CAGGGGCAGGTGGGGCAGGTTGG - Intronic
1176257069 20:64158316-64158338 CAGGGGCAGGTGGGGCAGGTGGG - Intronic
1176257175 20:64158611-64158633 CAGGGGCAGGTGGGGCAGGTGGG - Intronic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758261 21:25373584-25373606 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178747859 21:35270697-35270719 CATTGGCAGGTTGATGGGGATGG - Intronic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179128522 21:38613853-38613875 CAGGGGCCGGCTGAAGAGGGGGG - Intronic
1179254153 21:39700383-39700405 CAAGGGGAGGTTGAGAAGGTGGG - Intergenic
1179617927 21:42593735-42593757 CAGGGGCTGGCCGAGGAGGGAGG + Intergenic
1179628380 21:42661388-42661410 CAGGGGCTGGGGGAGGGGGATGG - Intronic
1179836175 21:44035049-44035071 GGAGGGCAGGTTGAGGAGGATGG + Intronic
1179908846 21:44437586-44437608 TAGGGGCAGGTACAGGAGTAGGG + Intronic
1180033170 21:45226020-45226042 CAGGGACTGGTGGAGGTGGATGG + Exonic
1180082634 21:45493761-45493783 GAGGGGCAGGGAGAGGACGAGGG - Intronic
1180082640 21:45493779-45493801 CAGGGGTAGGGAGAGGACGAGGG - Intronic
1180184856 21:46134455-46134477 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180754063 22:18148051-18148073 CTGGAGCAGGTTGAGGAGGGTGG - Intergenic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181051698 22:20241073-20241095 CAGGAGGAGGCTGAGGATGAGGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181508999 22:23380545-23380567 GAGGGGCAGGGGCAGGAGGAGGG - Intergenic
1181780420 22:25188813-25188835 GAGGGGGAGGTGGAAGAGGAGGG + Intronic
1181786323 22:25229857-25229879 GAGGGGCAAGTTGAGGCAGAGGG + Intronic
1181818494 22:25457680-25457702 GAGGGGCAAGTTGAGGCAGAGGG + Intergenic
1181886087 22:26023514-26023536 CAGGAGGAGGAAGAGGAGGAGGG - Intronic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182043042 22:27253333-27253355 GAAGAGCAGGTTAAGGAGGAAGG - Intergenic
1182113857 22:27743652-27743674 GAGGAGCAGGCTGGGGAGGAAGG - Intergenic
1182418689 22:30238048-30238070 CAGGGCCAGGTGGATGGGGAGGG - Intergenic
1182681483 22:32083165-32083187 CCAGGGCAGGCTGAGGAGGTGGG + Intronic
1182732187 22:32504456-32504478 AAGGAGCAGGCTGGGGAGGAAGG - Intergenic
1182737924 22:32544350-32544372 CAGGAACATGTTGAGGAGAATGG - Intronic
1182763086 22:32738614-32738636 CAGGGGTAGGTTTTGGTGGAGGG + Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183080545 22:35453043-35453065 CAGGGGCAGGGGGAGGGTGACGG + Intergenic
1183334215 22:37237382-37237404 CAGGGAGAGGTGGAGCAGGAGGG + Intronic
1183372634 22:37442845-37442867 CACCTGCAGGTTGAGGAAGATGG + Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183661033 22:39221377-39221399 CAGGGGCAGGTGGGACAGGATGG + Intergenic
1183792462 22:40083878-40083900 CAGGGAAGGGTTGGGGAGGAGGG + Intronic
1183987019 22:41575568-41575590 CACTGCCAGGCTGAGGAGGAGGG - Exonic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184299036 22:43544077-43544099 CAGGGGGAGGCTGGGGAGGGAGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184405988 22:44301096-44301118 CAGGGGCCGGGTGCGGACGATGG + Intronic
1184458853 22:44626027-44626049 TGGGGGCAGCCTGAGGAGGAGGG - Intergenic
1184561823 22:45268281-45268303 AAGGGGCAGGGGGTGGAGGATGG - Intergenic
1184620345 22:45671986-45672008 AAGGGGGAGGATGACGAGGAGGG - Exonic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184923554 22:47622411-47622433 CAGGGCCAGATTGGGGAGGAAGG + Intergenic
1184939144 22:47748169-47748191 AAGGGGCAGAGGGAGGAGGATGG + Intergenic
1185243952 22:49763403-49763425 CAGGGGCTGGGGGAAGAGGAAGG + Intergenic
1185286036 22:50000292-50000314 GGGGGGCGGGTGGAGGAGGATGG - Intronic
1185363816 22:50425631-50425653 GAGGGGGAGGATGAGGAGAAAGG - Intronic
1185419895 22:50729343-50729365 CAGGGGCAGGGAGAGGGGGTGGG + Intergenic
950106478 3:10392106-10392128 CATGGTCAGGTTGAGGAGCCAGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950389738 3:12687114-12687136 CATGGGGAGGTGGAGGTGGAAGG + Intergenic
950447635 3:13047444-13047466 CTGGGGCAGGCTGGGGTGGACGG + Intronic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951762893 3:26164440-26164462 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
952187178 3:30982692-30982714 AACAGGCAGGTAGAGGAGGAGGG - Intergenic
952450026 3:33422742-33422764 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
952565472 3:34652376-34652398 CAGGGGAAGGATGAGCGGGACGG - Intergenic
952866231 3:37857003-37857025 CAGGGGCAGGCTGCGAATGATGG + Intergenic
952895346 3:38075087-38075109 CATGAGCAGCCTGAGGAGGAGGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953177101 3:40562649-40562671 GAGGAGCAGGTTGGGGAGGAGGG - Intronic
953340374 3:42129413-42129435 CAGGGGGAGGATGTGCAGGAAGG - Intronic
953365420 3:42340458-42340480 GAGGGGGAGGAGGAGGAGGAGGG + Intergenic
954292873 3:49658931-49658953 GAGTGCCAGGCTGAGGAGGATGG + Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
954511147 3:51127017-51127039 CATGCGCAGGCTGAGGAGCAAGG + Intronic
954634590 3:52064689-52064711 CAGAGGCAGGCAGAGGAGAAGGG + Intergenic
954711560 3:52507580-52507602 CAGGGGCAGGATGGGGAGAGGGG - Intronic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
955370651 3:58348665-58348687 CTTTGGCAGGTTGAGGAGGGAGG + Intronic
956110406 3:65864778-65864800 CAGTGGCAGGTTGAGTAGGCAGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956146912 3:66199508-66199530 CAGGGTCAGGTTGAGGATTGAGG - Intronic
956216236 3:66852336-66852358 CATGTGCAAGTTGAGGAGAAAGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956698293 3:71937150-71937172 CAGGTGGAGGTGGAGGTGGAAGG - Intergenic
957004577 3:74929652-74929674 TAGGGGCTGGTTGAGAAAGAAGG + Intergenic
957562874 3:81846504-81846526 AAGTTTCAGGTTGAGGAGGATGG - Intergenic
958822285 3:98989173-98989195 CAGTGGCAGGGTCAGGAGGGAGG - Intergenic
958867652 3:99519655-99519677 AAGGGGAAGGCAGAGGAGGAGGG + Intergenic
958930621 3:100204081-100204103 GAGAGGGAGGCTGAGGAGGAGGG + Intergenic
959543800 3:107570722-107570744 GAGGAGCAGCTTGGGGAGGAGGG + Intronic
959972352 3:112421606-112421628 GAGGAGCAGGCTGGGGAGGAAGG + Intergenic
960636798 3:119792528-119792550 CTGGGGCAGCTGGAGGAGCACGG - Intronic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
961168418 3:124779412-124779434 TAGGGGGAGGTTGGGGAGGCTGG - Intronic
961511486 3:127406552-127406574 CCGAGGCAGGCTGGGGAGGAGGG - Intergenic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961644774 3:128387044-128387066 CAGGGCCCAGGTGAGGAGGATGG + Intronic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
962804240 3:138915682-138915704 CCGGGGCGGGAAGAGGAGGAGGG + Intergenic
964408924 3:156378521-156378543 CAGAGAAAGGTTGAGGAAGAAGG - Intronic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
964541313 3:157782725-157782747 GATGGGCATGTTGAGGAGTAAGG - Intergenic
964773355 3:160248394-160248416 GAGGGGAAGGTTGAGAAGAACGG - Intronic
965501336 3:169459671-169459693 AGGGGACAGGTTGAGGGGGAAGG - Intronic
966148352 3:176838217-176838239 CAGTGGCAGGTGGAGGGGAATGG - Intergenic
966208455 3:177428221-177428243 CAGGGGCAGGATGAAGAGACGGG + Intergenic
966350807 3:179031959-179031981 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966350823 3:179031989-179032011 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966350833 3:179032007-179032029 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966591748 3:181691427-181691449 CAGGAGGAGATAGAGGAGGAAGG + Intergenic
966908476 3:184544503-184544525 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
966925414 3:184641427-184641449 CAGGGGCAGGTTGAGGGGAGTGG + Intronic
967049447 3:185769205-185769227 CATGGGGAGGCTGAGGAGGATGG + Intronic
967963292 3:194941971-194941993 CAGGGGCGGGTGGAGAAGGGTGG - Intergenic
967991133 3:195131681-195131703 CAGGGCCAGGGTGATGAGGCAGG + Intronic
968486129 4:863424-863446 CAGTGGCAGGTTTGGGAGGACGG + Intronic
968878646 4:3287510-3287532 CAGGGGCAGGTTCAGGAATCAGG - Intergenic
968889374 4:3359380-3359402 GAGGGGGAGGGGGAGGAGGAAGG - Intronic
969243814 4:5919412-5919434 CAGGGGCAGGTGGGGGTGGGGGG + Intronic
969347879 4:6580581-6580603 CAGCTGCATCTTGAGGAGGAGGG - Intronic
969454721 4:7294717-7294739 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969454792 4:7294899-7294921 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969713509 4:8857802-8857824 CAAGGGCAAGGGGAGGAGGAGGG - Intronic
969713817 4:8859011-8859033 CAGGAGCAGAGTGGGGAGGAAGG + Intronic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
969853103 4:9977551-9977573 CAGGAGCAGGGGGAGGGGGAGGG - Intronic
971123275 4:23726066-23726088 GAGGAGCAGGCTGGGGAGGAAGG + Intergenic
971172084 4:24243730-24243752 AAGGGCCAGGCTAAGGAGGAAGG - Intergenic
971353561 4:25873930-25873952 CTGGGTCAGGTTTAGCAGGATGG + Intronic
973112087 4:46409249-46409271 CAGTGGTAGCTTGATGAGGATGG - Intronic
973156484 4:46961335-46961357 CGGGAGGAGGATGAGGAGGATGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973979579 4:56296753-56296775 CAGGGGCAGGAAGAGCAGCAAGG - Intronic
974229253 4:59088889-59088911 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
974324350 4:60394585-60394607 CATTGGGAGGTTGAGGAGGGTGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975113334 4:70651025-70651047 CATGGGGAGGTTGAGGTGGGTGG - Intronic
975691749 4:76972116-76972138 GGGGGGCAGGTAGTGGAGGAAGG - Intronic
975896185 4:79093768-79093790 CAGGGGCAGGATGTGGGGGGAGG - Intergenic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977168574 4:93731197-93731219 CAGGAGCAGGTTGAGGCGCAGGG + Intronic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977927445 4:102717320-102717342 CAGTGAGAGGTTGAGGAGGATGG + Intronic
978324737 4:107539576-107539598 CAGGGATGGGTTGAGGATGAGGG + Intergenic
979154672 4:117369312-117369334 CAGGAGCAGGTGGGGCAGGAGGG - Intergenic
979507244 4:121512643-121512665 CATCTGCAGGCTGAGGAGGAAGG + Intergenic
980491447 4:133533239-133533261 AAGGAGCAGCTTGGGGAGGAGGG + Intergenic
981121580 4:141057537-141057559 GAGGGGAAGGTTGGGGAGGTGGG - Intronic
981318542 4:143365231-143365253 CAGATGCAGGTAGAGGAAGAAGG + Intronic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981761430 4:148199634-148199656 GACAGGCAGGTTGAGGAGCAAGG + Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982313185 4:154006361-154006383 CAGTGCCAGGCTAAGGAGGATGG + Intergenic
982318711 4:154057918-154057940 GAGGAGCAGCCTGAGGAGGAGGG - Intergenic
983172606 4:164552710-164552732 CAGGTGCAGTTTCATGAGGAAGG - Intergenic
983613387 4:169674983-169675005 CTTTGGCAGGCTGAGGAGGACGG - Intronic
983881502 4:172938295-172938317 GAGGAGGAGGTGGAGGAGGAGGG + Intronic
983938426 4:173518785-173518807 CAGGAGCAGGTTCAGGAGCTGGG + Intergenic
985073264 4:186189822-186189844 CAGGTGCAGGATGAGGTGGGTGG - Intergenic
985073447 4:186191033-186191055 CAGGGGCGGGTGGGAGAGGAAGG - Intergenic
985294823 4:188425503-188425525 CAAGAGCAGGATGGGGAGGAAGG - Intergenic
985657010 5:1137532-1137554 TCCAGGCAGGTTGAGGAGGAGGG - Intergenic
985961651 5:3307263-3307285 CATCTGCAGGTGGAGGAGGAGGG + Intergenic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986183619 5:5416953-5416975 GAGGAGGAGGGTGAGGAGGAGGG + Intergenic
986219367 5:5753735-5753757 CCTGGGCAGGATGAGAAGGATGG - Intergenic
986796215 5:11214877-11214899 AAGGGGAAGATTGAGGATGAAGG - Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
988314176 5:29602654-29602676 CATCTGCAGGCTGAGGAGGAAGG + Intergenic
988611960 5:32735245-32735267 CAGAGCCAGATGGAGGAGGAGGG - Intronic
989983164 5:50666903-50666925 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
990457420 5:56001369-56001391 CAGGGGGAGTTTGAGAAGCAAGG + Intergenic
990509919 5:56480971-56480993 CAGGGGCGGGGTGGGGAGGGGGG + Intronic
990524182 5:56608382-56608404 CAGGGGCAGGGAGCGGGGGATGG + Intergenic
991082484 5:62616050-62616072 GAGGGGGAGGTGGGGGAGGAAGG + Intronic
992202903 5:74401598-74401620 CAGGGACTGGTTGGGGAGAATGG - Intergenic
993036441 5:82762603-82762625 CATCTGCAGGTTGAGGAGCAAGG - Intergenic
993501049 5:88667356-88667378 CCAGCGCAGGTTAAGGAGGAAGG + Intergenic
994501163 5:100580421-100580443 CATGTGCAGGCTGAGGAGCAAGG + Intronic
995189148 5:109302371-109302393 CAGGGGTATGATGTGGAGGAGGG - Intergenic
996121740 5:119680880-119680902 CAGGGGCAGGCTGGGAAGGCTGG - Intergenic
997180094 5:131819428-131819450 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
997269648 5:132526072-132526094 GAGGGGCAGGGTGAGAAGGCAGG + Intergenic
997368720 5:133342315-133342337 CAGGGGCAGGTTGCAGAGAAGGG + Intronic
997410788 5:133689185-133689207 CAAGGGCAGATTGAAGAGGTGGG - Intergenic
997823851 5:137089106-137089128 CAGGTGCAAGGGGAGGAGGAGGG + Intronic
997872373 5:137516956-137516978 CAGAGGCAAGTTCAGGAGGAGGG + Intronic
998006783 5:138662316-138662338 CAGGGGGAGATTATGGAGGAAGG + Intronic
998006870 5:138662938-138662960 CATGGGAAGGATGAGGAGGTAGG - Intronic
998043937 5:138971389-138971411 CAGGGGCAGGTCTACAAGGATGG - Intronic
998160055 5:139808264-139808286 CAGGGGCAGACAGGGGAGGAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
998472505 5:142394172-142394194 GAGGGGGAGGTGGAGGTGGAGGG - Intergenic
998885213 5:146686898-146686920 CAGCGGGAGGTTGGGGAAGAAGG + Intronic
999176552 5:149635833-149635855 CAGGGGCAGTTTCCTGAGGAAGG + Intergenic
999198415 5:149798949-149798971 CAGGGGCTGGGTGCTGAGGAAGG + Intronic
999300579 5:150487691-150487713 CATGGGCAGCTGGAGCAGGAGGG + Intronic
999350073 5:150861451-150861473 CAGGGTCAGATTCAAGAGGAGGG + Intronic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
999424105 5:151471978-151472000 AAGGGGCAGGGTGGGGAGGAGGG - Intronic
999624190 5:153502683-153502705 GAGGTCCAGGTTGAGGAGGCAGG + Intronic
1000304467 5:159983114-159983136 CTGGGTCAGGTTGAAGGGGAAGG - Intergenic
1000608704 5:163351945-163351967 CAGTGGCAGGCCTAGGAGGAAGG + Intergenic
1001024584 5:168213478-168213500 CAGGGGCTGGGAGAGGTGGAGGG - Intronic
1001128258 5:169040509-169040531 CAAGGGCAGGATGGGGATGAGGG - Intronic
1001483487 5:172104139-172104161 CAGTGGCAGGAAGGGGAGGAAGG - Intronic
1001706044 5:173741758-173741780 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1001758987 5:174192256-174192278 CAGGTGAGGGTTGTGGAGGAGGG - Intronic
1001835355 5:174826656-174826678 CAGGGCCCGGGTGAGGAGGGAGG + Intergenic
1002039266 5:176500038-176500060 CAGGGGAAGGTTCAGGGGGCAGG - Exonic
1002307443 5:178292181-178292203 CAGGAACAGATCGAGGAGGAGGG - Intronic
1002443189 5:179274813-179274835 CAGGGGCTGGTGGAGGTGCAGGG + Intronic
1002799043 6:503867-503889 ACGGGACAGGCTGAGGAGGAAGG - Intronic
1003245139 6:4376691-4376713 CAGGGCCAGGTGGAACAGGAAGG - Intergenic
1004292126 6:14377176-14377198 CTGGGGCACGCTGAAGAGGAAGG - Intergenic
1004753298 6:18585359-18585381 CAGGAGCAGGTGGGGGAGGGTGG - Intergenic
1005390944 6:25332578-25332600 GAGGGACATGTTGAGGAAGAAGG + Intronic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1006388305 6:33744639-33744661 CAGTGGCTGGGTGAGGAGGTGGG - Intronic
1006409317 6:33863136-33863158 TGGGGGGAGGTGGAGGAGGAAGG + Intergenic
1006689030 6:35863624-35863646 GAGGGGGAGGTGGAGGGGGAGGG + Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007163645 6:39812584-39812606 CAGGGGCAGGGTGGGGAGGCGGG - Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007342661 6:41201310-41201332 CTGGGGGAGGTTGGGGAGGGCGG - Intergenic
1007347893 6:41247221-41247243 CTGGGGCGGGTTGGGGATGACGG + Intergenic
1007509845 6:42366512-42366534 CAGGTGCAGGAAGAGGAGGGAGG - Intronic
1007596070 6:43052184-43052206 GAGGGGCAGTGTGGGGAGGAAGG - Exonic
1007654817 6:43445687-43445709 CAGGAGGATGTTGAGGATGAAGG - Exonic
1007720848 6:43884755-43884777 CAGGGGCAGGCAGGGGAGGGAGG - Intergenic
1008052698 6:46916009-46916031 CAGCTGCAGGATGATGAGGATGG - Intronic
1008380871 6:50838602-50838624 TAGGGGAAGATTGGGGAGGAGGG + Intronic
1008467022 6:51842574-51842596 CGGGGGGAGGTTGAGAAGGGTGG - Intronic
1009415181 6:63408128-63408150 CATGGGTAGCTTGATGAGGATGG - Intergenic
1009750114 6:67871337-67871359 CTGGGGCAGTCTGGGGAGGAGGG - Intergenic
1009750399 6:67873024-67873046 CTGGGGCAGTCTGGGGAGGAGGG + Intergenic
1010071819 6:71752627-71752649 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1010141815 6:72621853-72621875 CGGGGGCAGTTTGGGAAGGAGGG + Exonic
1010776141 6:79888028-79888050 AGGGGGCAGGGAGAGGAGGATGG + Intergenic
1011626797 6:89289689-89289711 AAGGGGAAGGGTGAGGAGGAGGG + Intronic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014242439 6:119032616-119032638 GAGGGGGAGGAGGAGGAGGAAGG + Intronic
1014910173 6:127082958-127082980 CAATGGCAGCTTGAGGTGGAAGG + Intergenic
1015402915 6:132806971-132806993 CATCTGCAGGTTGAGGAGCAAGG - Intergenic
1015591832 6:134829797-134829819 CAGAGGCTCGTTGGGGAGGATGG - Intergenic
1016121553 6:140348363-140348385 CAGGGACAGGATGTGGAAGAGGG + Intergenic
1016765120 6:147783988-147784010 CAATGGCAGGTTCAGGAGGGAGG + Intergenic
1017008178 6:150043335-150043357 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1017079977 6:150658749-150658771 TAAGGGCAGGGTGAGGAGCAGGG - Intronic
1017643474 6:156516728-156516750 CAGGGGCAGGGTGGGGAAGGAGG - Intergenic
1017861153 6:158398403-158398425 CAGTGGGTGGGTGAGGAGGAGGG - Intronic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1017893774 6:158661155-158661177 GAGGGGCAAGTTGAGAAGAATGG + Intronic
1018215104 6:161518765-161518787 CAGGGGCTGCTAGAGGTGGATGG - Intronic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018867810 6:167759285-167759307 CAGGAGCAGGTTCTGCAGGAAGG + Intergenic
1019028645 6:168992168-168992190 CAGGGGCACGTTGGGGGGCAGGG - Intergenic
1019292108 7:255945-255967 CAGGGACAGGTCGGGCAGGAAGG - Exonic
1019294146 7:265099-265121 CAGGGGCAGGAGGGGTAGGAGGG + Intergenic
1019298389 7:290781-290803 GAGGGACAGGTTGTGGCGGATGG - Intergenic
1019463277 7:1172667-1172689 GAGGGGCTGGATGAGGAGCAGGG - Intergenic
1019479855 7:1261422-1261444 CAGGGGATGGTTTGGGAGGATGG + Intergenic
1019551774 7:1606761-1606783 GAGGGACAGGGAGAGGAGGAAGG - Intergenic
1019554825 7:1624026-1624048 CAGGGACTGAGTGAGGAGGAGGG - Intergenic
1019746283 7:2701986-2702008 CAGGGGCCGGGTCAGGAGGTGGG + Intronic
1020122602 7:5513518-5513540 CAGGGTCAGGATGGGAAGGACGG + Intronic
1020794108 7:12661221-12661243 CAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1020958479 7:14772876-14772898 AAGGGGAAGGATGAGCAGGAGGG - Intronic
1021729241 7:23580423-23580445 CAGGGGCAGGTGGGGGTGGGTGG + Intergenic
1021799586 7:24290881-24290903 CTTGGGCAGGCTGAGGAGGGAGG - Intronic
1022060764 7:26792175-26792197 CAGGGGCTGGGTGTGGAGGCAGG + Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022510321 7:30931304-30931326 CAGAGACAGGTTGTGGAGGCTGG + Intergenic
1023319335 7:38976202-38976224 CAGTGGGAAGTTGCGGAGGAGGG - Intergenic
1023698982 7:42874656-42874678 GAGGAGCAGGCTGGGGAGGAAGG + Intergenic
1023821935 7:43985462-43985484 GAGGGGCAGGAGGAGCAGGAGGG - Intergenic
1023962491 7:44938493-44938515 CAGGTGGAGGTTGAGGAAGGTGG + Intergenic
1023969135 7:44978608-44978630 CAGGGGTGGGTTGAGGTGGTGGG + Intronic
1023996510 7:45162023-45162045 CAGGGGCAGCTTTAGGGTGAAGG + Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024326050 7:48109948-48109970 CTGGGGCAGGCTGAGGATGCAGG + Intergenic
1024978697 7:55137636-55137658 CAGGGGCAGGTTCAGGAAAGTGG - Intronic
1025228329 7:57182211-57182233 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1025943888 7:66092103-66092125 CAGGGGGAGGGTGAGGAGATGGG + Intronic
1026000754 7:66557860-66557882 CAGGGGCAGATGGAGGGGGTGGG + Intergenic
1026159016 7:67852618-67852640 GAGGGATAAGTTGAGGAGGATGG + Intergenic
1026164482 7:67897843-67897865 CAGGGGCTTGTTCAGAAGGATGG + Intergenic
1026221147 7:68398689-68398711 CAGGGGCAGGAAGGGAAGGAGGG + Intergenic
1026323070 7:69284317-69284339 CAGGGCCAGGCTGAGGTGGCGGG - Intergenic
1026371306 7:69702360-69702382 CAGAGGCAGGGTGAGAAGGAAGG + Intronic
1026840732 7:73668731-73668753 CAGGGGCAGGGAGGGGAGGTTGG + Intronic
1026878640 7:73894215-73894237 CAGGGTGAGGTTGGGGTGGAGGG + Intergenic
1026965032 7:74434084-74434106 CTGAGGCTGGCTGAGGAGGAAGG + Intergenic
1027254217 7:76420169-76420191 AAGGAGGAGGTGGAGGAGGAGGG - Intronic
1028058707 7:86282241-86282263 CAGGGGCGGGTGGGGGAGGGGGG + Intergenic
1028535461 7:91886856-91886878 GAGGGGCAGGGGGAGGGGGAGGG - Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029548109 7:101222040-101222062 AAAGTGCCGGTTGAGGAGGAGGG + Intronic
1029599035 7:101553215-101553237 CAGGGGCAGGCTGGGCAGGCAGG - Intronic
1030005301 7:105112637-105112659 CAGGTGGTGGTGGAGGAGGAGGG - Exonic
1030496753 7:110310347-110310369 GATGGGCAGGTAGAGAAGGAGGG + Intergenic
1031045077 7:116878654-116878676 CAGGGTCAAGTGGAGGGGGAAGG + Intronic
1031595076 7:123640666-123640688 GAGGGGGAGGGGGAGGAGGAGGG + Intergenic
1031597305 7:123662861-123662883 GAGGGGGAGGAGGAGGAGGAGGG - Exonic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032089477 7:128904105-128904127 GAGGGGCAGCTTTATGAGGAGGG - Exonic
1032129309 7:129215722-129215744 GAGGGGCAGGGGGAGGGGGAGGG - Intergenic
1032441101 7:131943739-131943761 CAGGAGCAGGTGGAGAAAGAAGG - Intergenic
1032521916 7:132551971-132551993 CAGGGCCAGGTTGAAGGGGGTGG + Intronic
1032923831 7:136579162-136579184 CATCTGCAGGTTGAGGAGCAAGG + Intergenic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034412172 7:150947399-150947421 GAGGGGGATGTTGAGGAGGCTGG + Exonic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034498219 7:151434280-151434302 CAGGGGCTTGTTGAGAACGAAGG - Intronic
1034720777 7:153290188-153290210 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035535581 8:388645-388667 CAGGGGCAGTTTGCGGAGTGAGG - Intergenic
1035574415 8:695833-695855 CAGGTGCAGGCTGATGGGGAGGG - Intronic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1035934854 8:3825531-3825553 CAGGGGCAGGTTCAGGGGTGTGG + Intronic
1036523524 8:9514359-9514381 CAGAGGCAGGTAGAGAAGGCTGG + Intergenic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1037306598 8:17511087-17511109 CTGGGGCCGGTTGAGGAGTTGGG + Intronic
1037809031 8:22075298-22075320 AAGGGGGAGGGGGAGGAGGAGGG - Intronic
1037841849 8:22250519-22250541 AATGAGCAGGTGGAGGAGGACGG + Exonic
1037903693 8:22703148-22703170 CGGGGGCAGGGTGCGGAGGGTGG + Intergenic
1038200379 8:25407573-25407595 CAAGAGTAGGTTGAGGAGGCCGG + Intronic
1038276844 8:26128264-26128286 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1038415291 8:27390389-27390411 CTTTGGGAGGTTGAGGAGGAAGG + Intronic
1039433648 8:37545131-37545153 AAGGGGAAGGGTGGGGAGGAAGG + Intergenic
1039568414 8:38567003-38567025 GAGGAGCAGGTGGAGGAGGAAGG + Intergenic
1039788938 8:40858786-40858808 CAGGGGCAGGAAGATGAGCACGG - Intronic
1039858534 8:41437004-41437026 CATGGGCAGGTGGTGGAGGTGGG - Intergenic
1039968162 8:42298927-42298949 CAGGGGCAGGGAGGGAAGGACGG - Intronic
1040071935 8:43195648-43195670 GAGGGGCTGGAGGAGGAGGAGGG + Intronic
1040079734 8:43274773-43274795 GAGGAGGAGGTAGAGGAGGAGGG - Intergenic
1040341867 8:46445135-46445157 CAGGGGGATGTTGAGGCAGAAGG - Intergenic
1040454680 8:47584869-47584891 CAGGGGCAGATGGAGTGGGAGGG - Intronic
1040484241 8:47855009-47855031 CAGAGGCAAGCTGAGGCGGAGGG + Intronic
1040871144 8:52101064-52101086 AAGGGGCAGGTGGAAGAGGCTGG + Intergenic
1041013888 8:53571538-53571560 CTGGTGCAGGTTGTGGGGGAGGG + Intergenic
1041411512 8:57561365-57561387 CTGGGGCTGGTTCTGGAGGAGGG - Intergenic
1042217299 8:66439195-66439217 AGGGGGAAGGTTGGGGAGGAAGG - Intronic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042597595 8:70466244-70466266 CAGCTGCAGGCTGAGGAGCAAGG + Intergenic
1044547543 8:93476407-93476429 CAGCTGCAGGCTGAGGAGCAAGG - Intergenic
1044689100 8:94859170-94859192 CTTGGGGAGGTTGAGGTGGAAGG + Intronic
1044721771 8:95157606-95157628 CAGGGGCTGGTTGAGGGGTTGGG + Intergenic
1045111406 8:98941440-98941462 CAGTGGAAGGCTGAGGAGAAGGG + Intronic
1045111454 8:98941696-98941718 GAGGAGGAGGTGGAGGAGGAGGG - Intronic
1045245739 8:100440358-100440380 CAAGGGCAGGTTGAGAAGGATGG + Intergenic
1045807908 8:106186925-106186947 CAGGGCCAGATTGAGGAACAGGG + Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046129883 8:109954228-109954250 CAGTGGCAGGGTGAGGTGGGGGG + Intergenic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047520433 8:125591700-125591722 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1047624342 8:126640791-126640813 CAGGGGCAGGTAGAGGAAGGAGG - Intergenic
1047680148 8:127246289-127246311 AAGGAGCAAGTTGGGGAGGAAGG + Intergenic
1047750327 8:127875762-127875784 CAAGGGAAGGGTGGGGAGGAAGG + Intergenic
1047909356 8:129510560-129510582 CACTGGCAGGCTGAGGTGGAAGG - Intergenic
1047960614 8:130009167-130009189 CAGTGGCAGGTTGAGAAGCAAGG - Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049288578 8:141789936-141789958 CAGCGGCAGGTGGAGCAGGGTGG - Intergenic
1049291243 8:141803456-141803478 CAGGTGCTGGTTTAGGAGGCAGG - Intergenic
1049386076 8:142343793-142343815 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1049428152 8:142546590-142546612 CTGGGGCAGGTTCTGGAGGTGGG + Intergenic
1049454842 8:142681594-142681616 GAGTGGCAGATGGAGGAGGATGG - Intronic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1049576260 8:143391319-143391341 AGGGGGCAGGGTGAGGTGGAGGG - Intergenic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049706559 8:144045865-144045887 CAGCGGCAGGCTGAGTGGGAGGG + Intronic
1050447484 9:5740537-5740559 CATCTGCAGGCTGAGGAGGAAGG + Intronic
1050801062 9:9615269-9615291 CAGGTGCTGGTGGAGGTGGAAGG - Intronic
1050932549 9:11348797-11348819 AAGGAGCAAGTTGAGGAAGAAGG - Intergenic
1051432007 9:16988797-16988819 CATAGGCAGCATGAGGAGGATGG + Intergenic
1051469367 9:17419788-17419810 CAGAGACAGGTAGAAGAGGATGG - Intronic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1051708843 9:19909319-19909341 CAGGGGCCTGTTGTGGGGGACGG + Intergenic
1052093842 9:24361345-24361367 CAGGGGCTGGTGGAGAAAGAAGG + Intergenic
1052334987 9:27309911-27309933 CAGGGGCTGGTGGTGGGGGATGG + Intergenic
1052918114 9:33939755-33939777 GAGGGGGAGGGGGAGGAGGAAGG + Intronic
1052918163 9:33939854-33939876 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1053120834 9:35546613-35546635 GAGGGGCAGGTGGAGGTGGTGGG + Exonic
1053154891 9:35770591-35770613 CAGGGGCAGGTAGAGAAGGAAGG + Intergenic
1054159400 9:61663479-61663501 CAGGGGCAGGGCGAGGAGCATGG + Intergenic
1054479172 9:65594484-65594506 CAGGGGCAGGGCGAGGAGCATGG + Intergenic
1054663186 9:67716127-67716149 CAGGGACAGGGTGAGGAGCGTGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055796169 9:79977077-79977099 CAGGGGTAGGTGTAGGAGGGTGG - Intergenic
1056293448 9:85167481-85167503 CAGGTGCTGGGGGAGGAGGAAGG + Intergenic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1057089577 9:92245106-92245128 GTGGGGCAGCTTGAAGAGGAGGG - Intronic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057281329 9:93713751-93713773 CAGGGACAGGGTGAGAAGGAAGG - Intergenic
1057387136 9:94614183-94614205 GAGGAGCAGGGGGAGGAGGAGGG + Intronic
1057706370 9:97397968-97397990 CAGAGGCAGCGAGAGGAGGAGGG - Intergenic
1058139542 9:101342591-101342613 GAGGGGCAGGGGGAGGGGGAGGG + Intergenic
1058480251 9:105385741-105385763 CAGGGGCGGGTAGGGGATGATGG + Intronic
1058575952 9:106401520-106401542 CAGGGGCAGGTTAAGAGGTAAGG - Intergenic
1058606296 9:106727169-106727191 CAGCTGCAGGCTGAGGAGCAAGG + Intergenic
1059072441 9:111152885-111152907 GAGGTGGAGGTGGAGGAGGAGGG + Intergenic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059481735 9:114596138-114596160 AAGGGGCAGGCTGAGGCAGATGG + Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1060051802 9:120383390-120383412 CAGTGGCAGCTTGAGGCGGGTGG - Intergenic
1060105108 9:120868758-120868780 GAGGGGCGGGGTGGGGAGGAGGG - Intronic
1060180892 9:121532988-121533010 GAGAGGCAGGTTTGGGAGGAAGG + Intergenic
1060293296 9:122324347-122324369 CAGGGCAAGGTTGAGGGAGAGGG + Intergenic
1060419839 9:123460460-123460482 CAGGTGGAGGTTGAGATGGATGG - Intronic
1060624703 9:125101105-125101127 CAGGCACAGATTGATGAGGAGGG + Intronic
1060979356 9:127783855-127783877 GAAGGTCAGGCTGAGGAGGAAGG - Intergenic
1060979750 9:127785491-127785513 CGGGGGCGGGCGGAGGAGGAGGG + Intergenic
1061043120 9:128151004-128151026 CAGGCGCAGGGTGAAGAGGCAGG + Intronic
1061414356 9:130438313-130438335 CAGGGGCAGGCTGAAGACAAGGG + Intergenic
1061429507 9:130522457-130522479 CAGGGTCAGGGTGTGGGGGAGGG - Intergenic
1061860807 9:133467935-133467957 CAGGGTCAGGCTGATGACGATGG - Exonic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061967613 9:134025184-134025206 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1061967620 9:134025202-134025224 AAAGGGCTGGATGAGGAGGAGGG - Intergenic
1061967640 9:134025266-134025288 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1062201857 9:135307156-135307178 CTGGGGGAGGAAGAGGAGGAAGG - Intergenic
1062282189 9:135757072-135757094 GAGGGGCAGGGTGGGGAAGAGGG - Intronic
1062460370 9:136660307-136660329 CAGAGGCAGGTACAGGAGGTGGG - Intronic
1062469737 9:136697070-136697092 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1062479987 9:136746655-136746677 CAGGCGCAGGTGCAGGGGGAAGG + Intronic
1062612338 9:137380645-137380667 CAGAGGGGGGTTGGGGAGGAGGG - Intronic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203782348 EBV:107687-107709 CAAGGGCAGGATCAGGATGATGG - Intergenic
1185499055 X:583980-584002 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1185660854 X:1727792-1727814 CTGGGGCAGCCTGGGGAGGAGGG + Intergenic
1186193896 X:7093159-7093181 CAGGGGCTGGGGGAGGGGGATGG - Intronic
1186827275 X:13352939-13352961 CACGGGGAGGCTGAGGAGGGTGG + Intergenic
1186864005 X:13701204-13701226 CAGTGGCAGGTAAAGGAGGAGGG - Intronic
1186906485 X:14116705-14116727 GAGTGGCTGGTTGAGAAGGAAGG + Intergenic
1186971825 X:14854344-14854366 AAGGGGCATGTTAAGGAGGAAGG - Intronic
1187391721 X:18890640-18890662 GTGGGGGAGGATGAGGAGGAGGG - Intergenic
1187575771 X:20553079-20553101 CAGGGGCTGGGTGTGGGGGAAGG - Intergenic
1188388682 X:29592848-29592870 AAGGAGCTGGCTGAGGAGGAAGG - Intronic
1188759758 X:34013029-34013051 AAGGGGAAGGTTGAGGTGCATGG + Intergenic
1189328052 X:40125027-40125049 GGGGGGCGGGTTGGGGAGGAGGG + Intronic
1189377139 X:40474886-40474908 CAGGGGCAGGAAGAGGGAGAAGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1189726187 X:43969904-43969926 CGGGAGGAGGTGGAGGAGGAAGG + Intronic
1190252436 X:48737388-48737410 CGGGGGTGGGGTGAGGAGGAAGG - Intergenic
1190328216 X:49219573-49219595 CTAGGGCAGGTGGAGGAGCATGG - Intronic
1190443539 X:50499765-50499787 CCTGGGAAGGTTGAGGAAGAGGG + Intergenic
1190708268 X:53048478-53048500 CAGGGGCGGGCGGAGGAGGAGGG - Intergenic
1191254002 X:58272030-58272052 CAGGGTGAGGTTGAGCAGGCTGG - Intergenic
1191254048 X:58272214-58272236 CAGGGGGAGGTTGAGAAGGCCGG - Intergenic
1191254142 X:58272600-58272622 CAGGGGGAGGTTTAGGAGGCTGG - Intergenic
1191254250 X:58273001-58273023 CAGGAGTAGGTTCAGGAGGCCGG - Intergenic
1191254815 X:58275129-58275151 CAGGGAAAGGTTGAAGAGGCTGG - Intergenic
1191255043 X:58276079-58276101 CAGGGAGTGGTTGAGGAGGCCGG - Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191255648 X:58278470-58278492 CAGGGGGAGGTTGAGGAAGCTGG - Intergenic
1191255784 X:58279016-58279038 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191255946 X:58279700-58279722 TAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256187 X:58280654-58280676 CAGGGGGAGGTTGAGGAGGTGGG - Intergenic
1191256295 X:58281051-58281073 CTAGAGGAGGTTGAGGAGGATGG - Intergenic
1191256396 X:58281419-58281441 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256448 X:58281602-58281624 CAGGGGCAGGTTGAGGAGACTGG - Intergenic
1191589063 X:62860723-62860745 CATGGGTAGGTTGATGGGGATGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1191955855 X:66641881-66641903 GAGGGGCAGGTTAGTGAGGATGG - Intergenic
1192044801 X:67660756-67660778 CATGGGTAGCTTGATGAGGATGG + Intronic
1192073509 X:67965723-67965745 CATGGGTAGCTTGATGAGGATGG - Intergenic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192350799 X:70354857-70354879 TGGGGCCAGGATGAGGAGGAAGG + Intronic
1194636143 X:96346907-96346929 CAGGGGTAGCTTGATGGGGACGG + Intergenic
1195119717 X:101738364-101738386 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1195169659 X:102253922-102253944 CAGGGTCGGGGTGGGGAGGAGGG - Intergenic
1195189198 X:102433177-102433199 CAGGGTCGGGGTGGGGAGGAGGG + Intronic
1195419213 X:104654715-104654737 CATTGGTAGGTTGATGAGGATGG + Intronic
1195753314 X:108178138-108178160 CCGAAGCAGGTTGAGGAGGGTGG + Intronic
1196135661 X:112207132-112207154 CTGGGGCTGGTTGTGGAAGAGGG - Intergenic
1197364441 X:125546259-125546281 CATGTGCAAGTTGAGGAGCAAGG + Intergenic
1197626424 X:128807419-128807441 CAGGGGAAGTTTGAGGACAAGGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199715737 X:150506298-150506320 AAGGGGAGGGTAGAGGAGGAGGG - Intronic
1200076633 X:153554503-153554525 CAGGGCCAGGCTGCGGAGGCTGG + Intronic
1200104292 X:153703746-153703768 GAGGGTCCGGGTGAGGAGGAGGG - Intronic
1200162395 X:154016271-154016293 TAGGTGCAGGGTGAGGAGGAGGG + Intronic
1200951866 Y:8905305-8905327 CGGGGGAAGGCTGGGGAGGATGG + Intergenic
1201063373 Y:10068175-10068197 CAGGGGGAGGTAGAGTAGAAAGG - Intergenic
1201190395 Y:11438827-11438849 CAGGACCAGGGTCAGGAGGAGGG - Intergenic
1201335618 Y:12878097-12878119 GAGGGGCAGGGGGAGGGGGAGGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202133041 Y:21632134-21632156 CAGGGGCAGGTAGATGGGCATGG - Intergenic
1202583217 Y:26403060-26403082 CAGGAGCAGGGTCAGGAGCAGGG + Intergenic