ID: 1035695435

View in Genome Browser
Species Human (GRCh38)
Location 8:1592079-1592101
Sequence TGTGTGTCTGGGCCCAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035695435_1035695441 4 Left 1035695435 8:1592079-1592101 CCCTTGTTGGGCCCAGACACACA No data
Right 1035695441 8:1592106-1592128 GCTGCGATGGGTGCAGAGCAAGG No data
1035695435_1035695440 -8 Left 1035695435 8:1592079-1592101 CCCTTGTTGGGCCCAGACACACA No data
Right 1035695440 8:1592094-1592116 GACACACAAACAGCTGCGATGGG No data
1035695435_1035695442 28 Left 1035695435 8:1592079-1592101 CCCTTGTTGGGCCCAGACACACA No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data
1035695435_1035695439 -9 Left 1035695435 8:1592079-1592101 CCCTTGTTGGGCCCAGACACACA No data
Right 1035695439 8:1592093-1592115 AGACACACAAACAGCTGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035695435 Original CRISPR TGTGTGTCTGGGCCCAACAA GGG (reversed) Intronic