ID: 1035695437

View in Genome Browser
Species Human (GRCh38)
Location 8:1592090-1592112
Sequence TCGCAGCTGTTTGTGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035695437_1035695441 -7 Left 1035695437 8:1592090-1592112 CCCAGACACACAAACAGCTGCGA No data
Right 1035695441 8:1592106-1592128 GCTGCGATGGGTGCAGAGCAAGG No data
1035695437_1035695448 30 Left 1035695437 8:1592090-1592112 CCCAGACACACAAACAGCTGCGA No data
Right 1035695448 8:1592143-1592165 CCCGCCCAGGCTTACCTAACGGG No data
1035695437_1035695442 17 Left 1035695437 8:1592090-1592112 CCCAGACACACAAACAGCTGCGA No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data
1035695437_1035695446 29 Left 1035695437 8:1592090-1592112 CCCAGACACACAAACAGCTGCGA No data
Right 1035695446 8:1592142-1592164 GCCCGCCCAGGCTTACCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035695437 Original CRISPR TCGCAGCTGTTTGTGTGTCT GGG (reversed) Intronic