ID: 1035695438

View in Genome Browser
Species Human (GRCh38)
Location 8:1592091-1592113
Sequence ATCGCAGCTGTTTGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035695438_1035695450 30 Left 1035695438 8:1592091-1592113 CCAGACACACAAACAGCTGCGAT No data
Right 1035695450 8:1592144-1592166 CCGCCCAGGCTTACCTAACGGGG No data
1035695438_1035695448 29 Left 1035695438 8:1592091-1592113 CCAGACACACAAACAGCTGCGAT No data
Right 1035695448 8:1592143-1592165 CCCGCCCAGGCTTACCTAACGGG No data
1035695438_1035695442 16 Left 1035695438 8:1592091-1592113 CCAGACACACAAACAGCTGCGAT No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data
1035695438_1035695446 28 Left 1035695438 8:1592091-1592113 CCAGACACACAAACAGCTGCGAT No data
Right 1035695446 8:1592142-1592164 GCCCGCCCAGGCTTACCTAACGG No data
1035695438_1035695441 -8 Left 1035695438 8:1592091-1592113 CCAGACACACAAACAGCTGCGAT No data
Right 1035695441 8:1592106-1592128 GCTGCGATGGGTGCAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035695438 Original CRISPR ATCGCAGCTGTTTGTGTGTC TGG (reversed) Intronic