ID: 1035695442

View in Genome Browser
Species Human (GRCh38)
Location 8:1592130-1592152
Sequence GCCCCAGCACACGCCCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035695437_1035695442 17 Left 1035695437 8:1592090-1592112 CCCAGACACACAAACAGCTGCGA No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data
1035695436_1035695442 27 Left 1035695436 8:1592080-1592102 CCTTGTTGGGCCCAGACACACAA No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data
1035695435_1035695442 28 Left 1035695435 8:1592079-1592101 CCCTTGTTGGGCCCAGACACACA No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data
1035695438_1035695442 16 Left 1035695438 8:1592091-1592113 CCAGACACACAAACAGCTGCGAT No data
Right 1035695442 8:1592130-1592152 GCCCCAGCACACGCCCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035695442 Original CRISPR GCCCCAGCACACGCCCGCCC AGG Intronic