ID: 1035696827

View in Genome Browser
Species Human (GRCh38)
Location 8:1604110-1604132
Sequence CAGTGTCCACAAAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035696827_1035696829 12 Left 1035696827 8:1604110-1604132 CCTTCTTCATTTTGTGGACACTG 0: 1
1: 0
2: 0
3: 14
4: 251
Right 1035696829 8:1604145-1604167 ACATATGGCCGTTATCGACATGG No data
1035696827_1035696828 -3 Left 1035696827 8:1604110-1604132 CCTTCTTCATTTTGTGGACACTG 0: 1
1: 0
2: 0
3: 14
4: 251
Right 1035696828 8:1604130-1604152 CTGCAGACACTGTTCACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035696827 Original CRISPR CAGTGTCCACAAAATGAAGA AGG (reversed) Intronic
902196965 1:14804941-14804963 AAATGTCAACAAAATGAACATGG - Intronic
902761199 1:18581708-18581730 TCGTGACAACAAAATGAAGATGG - Intergenic
904365606 1:30009243-30009265 CAGTGTCCTCATAATTAAAATGG + Intergenic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
905795295 1:40812682-40812704 CAGCGTCCGCCAAATGGAGATGG + Intronic
908947785 1:69521228-69521250 CAGTATCCTCAATGTGAAGATGG - Intergenic
911165781 1:94723415-94723437 CAGTGTCCTGAACATGAAGCAGG - Intergenic
912707821 1:111927950-111927972 CAGTGACCTCAAAATGCTGAGGG - Intronic
914752558 1:150545401-150545423 CAGTGTCCACAAACTTAATCTGG + Intergenic
915054698 1:153115589-153115611 GAATGGCCACAACATGAAGAGGG + Intergenic
918191144 1:182175654-182175676 CATTATCCATAAAATGAAGGTGG + Intergenic
921636102 1:217495447-217495469 CAGTGTCCTCAAAATTAAAAGGG + Intronic
921800010 1:219391960-219391982 CAGTGACCACCAAATGAAGGAGG - Intergenic
922310781 1:224388200-224388222 CAGAATCCACAAAGAGAAGAGGG - Exonic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
924132699 1:240928324-240928346 AAGTGTCCACCAAATACAGAAGG - Intronic
1065180290 10:23118159-23118181 CTGTGTCCCCAAAATTAATAGGG - Intronic
1065363442 10:24911480-24911502 AAATGTCCACAAACTGATGAAGG - Intronic
1067983932 10:51120495-51120517 CAGGGGCCAGAAAATGTAGAAGG - Intronic
1069515492 10:69073750-69073772 CAGTTCCCACAAAGTGAAGATGG - Intergenic
1069847074 10:71379818-71379840 CAGTGTCCACAAAGTGCACTCGG - Intergenic
1072579577 10:96728989-96729011 CAGTGTCAATCAAATCAAGATGG + Intergenic
1073917757 10:108426558-108426580 CTGTGTCCACAAGCTGAAGATGG + Intergenic
1076758359 10:132587192-132587214 CAGTGTCCACAGAACTCAGAGGG + Intronic
1077445104 11:2587161-2587183 CAGTGGCCACACAGTGAGGAAGG - Intronic
1079238841 11:18708155-18708177 CACTGTCCACATAACCAAGATGG - Intronic
1079670942 11:23170222-23170244 CAGTGTTGACAAAATGTAGGGGG - Intergenic
1080561976 11:33472419-33472441 AAGTGTCCTTAAAAGGAAGAGGG - Intergenic
1081205824 11:40274466-40274488 CAGAAACCACAATATGAAGAAGG + Intronic
1082584800 11:54923441-54923463 CAGTGTTCACAAACTGCAAAAGG + Intergenic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086316774 11:85603261-85603283 CAGTTTCCCCAAAATGATGGTGG + Intronic
1087294306 11:96351985-96352007 CAGTGTCCACAAAAAAAGCAAGG - Intergenic
1087475971 11:98634933-98634955 TAGTGTCCACATAATTATGAAGG - Intergenic
1087871101 11:103294271-103294293 CAATGTCCAGACAATGATGAAGG - Intronic
1088608619 11:111555904-111555926 CTGTGTCCATAAAATGAAATAGG + Intronic
1088885565 11:114003706-114003728 CAGTGTTCATCAGATGAAGAGGG - Intergenic
1089485262 11:118840780-118840802 CTGTGTCAACAAAATGATGATGG - Intergenic
1089514206 11:119021435-119021457 CAGTTTTCAATAAATGAAGAGGG - Intronic
1091672005 12:2458501-2458523 CAGATACCACAAACTGAAGAGGG - Intronic
1093930762 12:24953016-24953038 CAGTGAGGACAAAATGAAGCTGG - Intergenic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1098395472 12:70012309-70012331 CAGTGGAGACAAAATAAAGAAGG + Intergenic
1098870989 12:75816637-75816659 AAGTGTACAAAAAATGATGAAGG + Intergenic
1101756385 12:107623841-107623863 CAGTGTTTACAAAATGAAATGGG + Intronic
1102873976 12:116435532-116435554 CAGTGTTCACTAAATGCAGATGG - Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1105069619 12:133226721-133226743 CAGTGACCTCAAAATGCATAGGG + Intronic
1107721843 13:43257648-43257670 CATTTTCCACAAAAAGAAAATGG + Intronic
1108886856 13:55196936-55196958 CAGTATCAAGAAAATGAAAAGGG - Intergenic
1109497647 13:63195216-63195238 ATGTGTCCACAAAAAGAAAAGGG + Intergenic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1115972473 14:38961360-38961382 CAGTTTCAACAAGATGAAAAAGG + Intergenic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1119101609 14:71884996-71885018 CAGTTTCCAGAAAATGGGGATGG - Intergenic
1122040328 14:98983317-98983339 CCATGTTCATAAAATGAAGAGGG - Intergenic
1122336665 14:100994002-100994024 CCGTGTCCCCAAAATGAACATGG + Intergenic
1123023433 14:105412610-105412632 TAGTGTCCCCAAAATGCAGCTGG - Exonic
1124026010 15:25966516-25966538 CAGCGTGCTCAAAAGGAAGAGGG + Intergenic
1125498172 15:40217312-40217334 CAGTGTCCACCCAATGCGGAAGG - Intronic
1126481661 15:49129760-49129782 CAATGTCAACAAAATCAAGGAGG - Intronic
1126516061 15:49539427-49539449 CAGTGCCCACAAAATGGCCATGG + Intronic
1127010872 15:54626169-54626191 TAGTGTCAACATAATAAAGAAGG - Intronic
1127759877 15:62128385-62128407 CAGTGTCCACACTATGCAGTGGG + Intergenic
1128619819 15:69139256-69139278 CAGTGGCCACATAATTAATATGG + Intergenic
1130635698 15:85617693-85617715 CTGTGTTCAAAAAAAGAAGAAGG + Intronic
1133072091 16:3253441-3253463 CAGTGGCCAAAGAATGGAGAAGG - Intronic
1134439417 16:14288989-14289011 AAGTGTGCACAAAATGACTAAGG + Intergenic
1136015249 16:27394462-27394484 CAGTGACCACAAAGTGCACATGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1142794776 17:2299315-2299337 CAGTGTCCAAGAAATGTAGCTGG + Exonic
1143181965 17:4988934-4988956 AAGTCTCCACAGACTGAAGAAGG - Exonic
1145045630 17:19613127-19613149 CAATGTCCTCAAAATTCAGAGGG - Intergenic
1149245970 17:54708272-54708294 CAGTTTACACATTATGAAGATGG + Intergenic
1149820858 17:59775723-59775745 CAGTGTCCTCAAGATGAGCAAGG + Intronic
1149975151 17:61258014-61258036 CAGTGTGCACAAAAATAATAAGG - Intronic
1151068738 17:71183680-71183702 TTATGTCCACAAAATAAAGATGG + Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1152480754 17:80550749-80550771 CAGTGGAGACAAAATGAAGCAGG - Intronic
1153293120 18:3520875-3520897 CAGAGTCCAGAAGGTGAAGAGGG - Intronic
1153619214 18:6961367-6961389 CAGTCACCAGACAATGAAGATGG + Intronic
1153896356 18:9565566-9565588 CAGTGAACACACAAAGAAGAAGG + Intronic
1154215872 18:12415756-12415778 CAGTGTCGGGAAGATGAAGAAGG - Intronic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1156832041 18:41503480-41503502 CAGTGTCAACAAATTTCAGAAGG - Intergenic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1157619229 18:49006460-49006482 CTCTGTCCATAAAATGGAGATGG - Intergenic
1157783255 18:50458672-50458694 CAGCAGCCACAAAATGCAGATGG - Intergenic
1158111384 18:53944127-53944149 GGGTGTCCACAAAGTAAAGAAGG - Intergenic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158738663 18:60113575-60113597 CAGTGTTCACATAATGTAGGAGG - Intergenic
1159952061 18:74491888-74491910 AAATGTCCAGAAAATGTAGATGG + Intergenic
1161784124 19:6312464-6312486 CAGTGGCCCGAAGATGAAGAAGG + Exonic
1162180065 19:8862658-8862680 AAGTGTCCAGAAAAAAAAGAAGG + Intronic
1163352466 19:16786533-16786555 AAGTGTCCCCAACATAAAGATGG - Intronic
1166326314 19:42053250-42053272 CAGTTTCCACAACTTCAAGATGG + Intronic
1166743896 19:45130771-45130793 CAGTGTCCACCACATGAAATCGG - Intronic
1167719961 19:51172514-51172536 CAGTTTCCACAAGAAGAAGGCGG + Intergenic
925507423 2:4584077-4584099 CAGGGTCCTGAAAATGAACATGG - Intergenic
926081454 2:9989889-9989911 CAGAATTCACAAAGTGAAGATGG - Intronic
926265134 2:11309410-11309432 CAGTATACACAAAATAAAGATGG + Intronic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927114629 2:19888265-19888287 CAGGGTCCACATCTTGAAGAGGG + Intergenic
927807761 2:26162995-26163017 TAGTGTGCACAAAGTTAAGAGGG - Intergenic
928054083 2:28033437-28033459 CAGAGTCCCCAATATCAAGAAGG - Intronic
928235305 2:29534129-29534151 TATTATCCACAAAATGAAGCTGG - Intronic
929044206 2:37774805-37774827 CAGTGTCCACAAGAAAATGAGGG - Intergenic
929338879 2:40787860-40787882 TAGAGTCCACTAAATGATGACGG + Intergenic
929489720 2:42385476-42385498 CAGTGTCAGCAAAATGCAGGAGG + Intronic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
930309734 2:49725109-49725131 AACTGTCCACAAACTGAAAAAGG - Intergenic
931100627 2:58996550-58996572 AAGTGGCCACAAACTGAGGAAGG + Intergenic
931633028 2:64318190-64318212 CAGAGTCCAAAAAATCAAAATGG - Intergenic
931867742 2:66430748-66430770 CTGTGTTCACAAAATGATAAGGG - Intergenic
932109148 2:68978909-68978931 CATTGTGCACAAAATGAACAAGG + Exonic
932268542 2:70388989-70389011 CAGGGTCTAGAAACTGAAGAAGG - Intergenic
933707023 2:85298929-85298951 CATTGTCCAGAAAATGAACCGGG - Intronic
937515715 2:122653195-122653217 CATTGCCTACAAAATGAAAATGG + Intergenic
938989645 2:136614902-136614924 CAGTGTCCACATAACAAAAAGGG - Intergenic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939909038 2:147957405-147957427 CAGTAACCAGAAAATGAAGTTGG + Intronic
940947284 2:159632020-159632042 CAATGCAGACAAAATGAAGAGGG + Intergenic
940982094 2:160015096-160015118 CTTTGTCCACACAATGAATACGG + Intronic
943655995 2:190509645-190509667 CAGTGCCCTCAAATTAAAGATGG - Intronic
946533804 2:220605399-220605421 CAGTGTGCCCAAAATAAAGCAGG - Intergenic
949062154 2:241967454-241967476 CACTGTCCCTAAAATGAAGCCGG + Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169463863 20:5820649-5820671 CAAAGTTCACAAAGTGAAGAAGG + Intronic
1169832157 20:9837313-9837335 CAGTATCATCAAAATGAAGTGGG - Intronic
1169839458 20:9918956-9918978 CAGTGTCCACCTAATGCAAACGG - Intergenic
1171958881 20:31479405-31479427 CAGTGTCCAGCAAGTTAAGATGG + Intronic
1173611867 20:44374317-44374339 CAGTGTCAAAAAAATAAAAAAGG - Intronic
1174669576 20:52293996-52294018 TAGTTTCCACAAAAAGAAGCTGG - Intergenic
1175011641 20:55743885-55743907 CACTTTCCACAAAATAAAAAAGG - Intergenic
1178328337 21:31663586-31663608 CTGTGTCCTCAAAAGGGAGATGG - Intronic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1181834899 22:25596844-25596866 CAATGCCTACAAAATAAAGAAGG - Intronic
1183369165 22:37422915-37422937 CAGTTTCCTCAATATGAAGTGGG - Intronic
1183835107 22:40445922-40445944 CAGTGTCATGAAAATGAAAAAGG - Intronic
1184317799 22:43710788-43710810 CACTCCCCACAAAATGAACATGG + Intronic
950086267 3:10260226-10260248 CAAGGTCCAGAAAAGGAAGAGGG + Exonic
950883185 3:16339606-16339628 CAAAGTCCAGAAAATGAAAATGG + Intronic
952949148 3:38504780-38504802 CAGTGTCAGAAAAATGTAGAAGG - Intronic
953538771 3:43796051-43796073 AAGTGTCCACAGACTGAAAATGG + Intergenic
958044332 3:88265611-88265633 CAGTATCAACAAAAAGAACAAGG - Intergenic
958910922 3:99994008-99994030 AACTGTCCAAAAAATCAAGATGG - Intronic
960259352 3:115547879-115547901 CAGAGTCCCCACCATGAAGAGGG + Intergenic
960856831 3:122110227-122110249 AAGTGTCCAAAAAATGAGGTTGG - Intronic
961094555 3:124143298-124143320 CAGTTTCCAGAAAATAGAGAGGG - Intronic
961968102 3:130927091-130927113 TGGTGTCCTCAAAATGAATATGG + Intronic
962426892 3:135278075-135278097 CAGTTTCCACATAAGGAATAGGG + Intergenic
965622184 3:170653009-170653031 CAGTGTCCACATACAGAAAATGG + Intronic
965780081 3:172276355-172276377 TAGTGTCCAAAAAATAATGATGG + Intronic
965894856 3:173563084-173563106 CAGTGTCCAGCAAATCAAGGTGG + Intronic
966118507 3:176494932-176494954 CACTGTCCAGGCAATGAAGATGG + Intergenic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
967164190 3:186765947-186765969 CAGTCTCCAGATAATGAAAAAGG + Intergenic
969991506 4:11268730-11268752 CAGTGTTCACAATATAAAGGAGG - Intergenic
970243704 4:14036056-14036078 CAGTGTCCAGAAAGAGAAGGTGG - Intergenic
971081014 4:23211239-23211261 CAGTGTTCACACAGTGATGAAGG - Intergenic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
972987322 4:44780405-44780427 CTCTGTCAACAAATTGAAGAGGG - Intergenic
974821871 4:67077240-67077262 TACTGTCCACAAAATCATGATGG + Intergenic
976229715 4:82828999-82829021 CAGAGTACCCAAAAAGAAGAAGG - Exonic
976404801 4:84651382-84651404 CAGTGTTTACAAAATAATGATGG + Intergenic
976966223 4:91044524-91044546 CAGTCTGCACAAAATGAGGCTGG - Intronic
977262087 4:94809619-94809641 CAATGTACACAAAAGAAAGAGGG - Intronic
977969368 4:103195919-103195941 CATTTTCCAAAAAATTAAGAAGG - Exonic
979144964 4:117235297-117235319 CAACGTCCTCAACATGAAGATGG + Intergenic
981136700 4:141219315-141219337 CAGTCTTCACAAGATGAAAATGG - Intergenic
981217650 4:142189996-142190018 CATTGGCCACATAATGAAAAGGG - Intronic
984432468 4:179666094-179666116 CAGAGTACACAAAATGTAGGGGG - Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
988885063 5:35547735-35547757 CAGTGCCCACACAGAGAAGAGGG - Intergenic
989999668 5:50878245-50878267 GACTCTCCACAAAATAAAGAAGG + Intergenic
992424437 5:76641861-76641883 CAGTGACCACACAAAAAAGAAGG - Intronic
993137966 5:83993972-83993994 CAGTGGCCAAAAAATGAAGCAGG - Intronic
993335032 5:86646469-86646491 AAGTATCAACAAAATGAAGAGGG + Intergenic
993644709 5:90447892-90447914 GACTGCCTACAAAATGAAGATGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994445118 5:99862582-99862604 CAGTGTCCATAAAATGCTGTTGG + Intergenic
994874208 5:105394006-105394028 CAATGTGCAGAAAATGAAAAGGG - Intergenic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
997089997 5:130845557-130845579 CAGGGTCCACAATGTGAATAAGG + Intergenic
997991137 5:138545148-138545170 CTGTGTCCACACTTTGAAGATGG + Intergenic
1000477942 5:161734745-161734767 CAGTTTCCAAACAATTAAGAAGG - Intergenic
1000979111 5:167797754-167797776 CACTGTCTAGGAAATGAAGAGGG + Intronic
1001136541 5:169107318-169107340 CAGGGTCTATAAAATCAAGAGGG - Intronic
1001241011 5:170069829-170069851 CAGAGTCCACAGGAAGAAGAGGG - Intronic
1002480682 5:179498765-179498787 CAGTTTCCAGAAAATGGTGATGG + Intergenic
1002571839 5:180144029-180144051 CAGTCTCCATAACCTGAAGAGGG - Intronic
1003112203 6:3259516-3259538 CAGTGTGCTCAAAATCCAGATGG - Intronic
1003294527 6:4813056-4813078 CAGTGTCCAGCAAAGGAACAAGG - Intronic
1003321571 6:5057112-5057134 AAGTGTCCACAAAGTTAAAAAGG + Intergenic
1004147000 6:13077276-13077298 CAGTTTCCACAAATGCAAGATGG - Intronic
1005134013 6:22545943-22545965 CAGCTTCCACAAAAAGAAGTAGG + Intergenic
1005493131 6:26365306-26365328 CAGAGCCCACAGAATAAAGACGG - Exonic
1006320099 6:33315041-33315063 CAGAGTCCACAAGGTGGAGATGG - Exonic
1007832499 6:44649265-44649287 CAGTCTCCACTCAAGGAAGAGGG - Intergenic
1009249770 6:61283706-61283728 CAGTGTTCCCAAACTGATGAAGG + Intergenic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1014028191 6:116672657-116672679 CAGTGTCTAAAAGATGAATATGG - Intergenic
1014096506 6:117467579-117467601 CAGAGCCCACAAGATAAAGATGG - Intronic
1015224308 6:130838978-130839000 CAGTGGACACAAAGTAAAGAAGG + Intergenic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017091943 6:150766983-150767005 TATTGTACACAAAATTAAGAAGG - Intronic
1017887549 6:158611437-158611459 CAAGGTCCAGAAAAGGAAGACGG - Intronic
1020498152 7:8882696-8882718 CAGTGGCCATAAAATTAATATGG + Intergenic
1021933068 7:25601234-25601256 CAGTGTAGATAAACTGAAGAAGG - Intergenic
1023002732 7:35828376-35828398 CAGTCTCAAAAAAAAGAAGAAGG - Intronic
1023263722 7:38383356-38383378 AAGTGACCAGAAAATGAAGCTGG + Intergenic
1023536033 7:41212085-41212107 CAATGTTGACAAAATGAAGGTGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025238545 7:57252066-57252088 CAATGCCCACAAATTGCAGAGGG - Intergenic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1027839385 7:83289267-83289289 CAGTGTGCACAAAATACACACGG + Intergenic
1028667055 7:93357904-93357926 AAGTGTTTACAAAATGTAGAGGG + Intronic
1031076977 7:117222292-117222314 CAGTTTCCAAAAAATGCAGGAGG + Intronic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1034064884 7:148126729-148126751 CAGTGACCACAATATGAACGGGG + Intronic
1035539128 8:418185-418207 CACTGTCCCCAAAACGCAGATGG - Intronic
1035696827 8:1604110-1604132 CAGTGTCCACAAAATGAAGAAGG - Intronic
1037351603 8:17964596-17964618 CAGTGTGCACTAGATGAAGAAGG + Exonic
1037431760 8:18820670-18820692 CAGTTTCCACCAACTGGAGATGG - Intronic
1038281857 8:26172974-26172996 AAGTGTCTTGAAAATGAAGATGG - Intergenic
1038933859 8:32225783-32225805 CAGTGTCTAAAAACTGAAGATGG + Intronic
1039373166 8:37007571-37007593 CAGTGTCCCTAATATGAAAAGGG - Intergenic
1039869898 8:41537221-41537243 CAGCATCCACCAAATGGAGATGG + Exonic
1041093522 8:54326786-54326808 AAGTCTCCCCAAAATGAATAAGG - Intergenic
1041513791 8:58677595-58677617 TAGTGGCCTCAAAAGGAAGAGGG + Intergenic
1041632956 8:60108704-60108726 CAGTGCCTACAAAATCAAGCAGG - Intergenic
1042334388 8:67614802-67614824 CAGTGGCCAAAGAATGGAGAAGG - Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1046891844 8:119430653-119430675 CTATGTCCACAAAATGAGGATGG + Intergenic
1049295575 8:141833228-141833250 CATTGTTAAGAAAATGAAGAAGG - Intergenic
1049651030 8:143769883-143769905 CAGTGTCCACAAAATTCTGCAGG - Intergenic
1051039591 9:12791137-12791159 CAGTGTTCACATAAGTAAGATGG + Intronic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1058224972 9:102348924-102348946 CAGAGTCCACAACATGTTGATGG + Intergenic
1058880034 9:109277980-109278002 CAGTGTCCAGAATATGTAGGAGG + Intronic
1060969473 9:127730081-127730103 CTGGATTCACAAAATGAAGAAGG - Intronic
1185875466 X:3698475-3698497 CCGTGTCCAGAAAAAGAAGTAGG + Intronic
1186353256 X:8761939-8761961 CAGTTTCCCAAATATGAAGAGGG + Intergenic
1186685023 X:11916765-11916787 CAGTGTCTATACCATGAAGAGGG + Intergenic
1186794478 X:13031103-13031125 CAGTTTCCCAAATATGAAGAGGG + Intergenic
1189155083 X:38748770-38748792 CCACATCCACAAAATGAAGATGG + Intergenic
1189563646 X:42216857-42216879 CAATGGCCACAAAATGCAGGTGG + Intergenic
1189933900 X:46044279-46044301 CAGTGGCCATTAAATGGAGAAGG + Intergenic
1190812283 X:53896397-53896419 CAGTGGCCACAGAATGCTGATGG + Intergenic
1191112270 X:56813274-56813296 CAGAGTCCACAAAAAGAATGGGG - Intergenic
1192453609 X:71259284-71259306 CAGTGTCCACAAATGTAAAATGG + Intergenic
1193230757 X:79042510-79042532 AATAGTCCCCAAAATGAAGAAGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194973388 X:100368666-100368688 CAGTGCCCAAAAGAGGAAGAAGG + Intronic
1196776883 X:119346346-119346368 CATTTGCCACAAAATGGAGATGG + Intergenic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1198486468 X:137092417-137092439 CAGTGGCCACACAATGGAAAAGG - Intergenic
1198632543 X:138656834-138656856 CAATGTCCAAAAAACAAAGAAGG + Intronic
1199495764 X:148450597-148450619 CTATGTCCACAAAATGGATATGG - Intergenic
1199603967 X:149561754-149561776 CAGGGTCCCCAAAATGAAATGGG - Intergenic
1199646422 X:149917720-149917742 CAGGGTCCCCAAAATGAAATGGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1202040467 Y:20677488-20677510 AAATGTCCACAAAAGAAAGAAGG + Intergenic