ID: 1035699483

View in Genome Browser
Species Human (GRCh38)
Location 8:1627133-1627155
Sequence GGCCAGGATGACCACCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035699483_1035699487 19 Left 1035699483 8:1627133-1627155 CCAAAAGGGTGGTCATCCTGGCC 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1035699487 8:1627175-1627197 AGGCTGTCTTCCTTCTTCCCAGG No data
1035699483_1035699486 -1 Left 1035699483 8:1627133-1627155 CCAAAAGGGTGGTCATCCTGGCC 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1035699486 8:1627155-1627177 CTCTCTTGTTGATAAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035699483 Original CRISPR GGCCAGGATGACCACCCTTT TGG (reversed) Intronic
900610150 1:3541294-3541316 GGCCACCATGACCACTCTTCCGG + Intronic
901948371 1:12721725-12721747 AGCCAGGGGGACCTCCCTTTTGG - Intronic
902041663 1:13496953-13496975 TGCCAGGATGACCTCCCTCTGGG - Intronic
902585397 1:17436042-17436064 GCCCATGATGCCCATCCTTTGGG - Intronic
902600748 1:17539295-17539317 GTCCAGGATTCTCACCCTTTTGG + Intergenic
905127665 1:35726912-35726934 GGGCAGGATCACCTCCCTTAGGG - Intronic
907356458 1:53878925-53878947 GGCCAGGATTTGAACCCTTTTGG - Intronic
912472950 1:109918247-109918269 GGCCATGCTGATAACCCTTTGGG - Intronic
915598486 1:156908377-156908399 GGCCAGGAAGACCTCCCCATTGG - Intronic
917752724 1:178068283-178068305 AACCAGGATGACCACCCTCAGGG - Intergenic
923268805 1:232336347-232336369 GGCCACCATGAGTACCCTTTTGG - Intergenic
924323346 1:242870946-242870968 GGCCAGGAAGACCCCCCGTATGG - Intergenic
1067157433 10:43794003-43794025 GGGCAGGATTACCGCCATTTGGG - Intergenic
1069834081 10:71297712-71297734 GGCCTGCATGGCCACCCTTCAGG - Intronic
1070204495 10:74243038-74243060 GGCCAGTATGACAGCCTTTTTGG - Intronic
1070282786 10:75062009-75062031 GGCCTGAATGACCACCCGTGGGG - Intergenic
1077911451 11:6575182-6575204 GGACAGGCTGACCACCTGTTAGG - Intronic
1078558936 11:12354034-12354056 GGCCATCCAGACCACCCTTTAGG - Intronic
1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG + Intergenic
1081670128 11:44938145-44938167 GGCCAGGCTGACCCACCATTAGG - Intronic
1081708646 11:45202405-45202427 GGCCAGGAAGAACTTCCTTTAGG + Intronic
1083817445 11:65143465-65143487 GGCCAGGATGGTCACCATGTTGG + Intergenic
1090425492 11:126604276-126604298 GGGCAGGAAGACCACCCTGAAGG + Intronic
1094728909 12:33152030-33152052 GGCCATGATGCCCACCCTGAAGG - Intergenic
1102587213 12:113931782-113931804 GGACAGGATGAGCTCCCTGTGGG - Intronic
1110546274 13:76759344-76759366 GGCCAGGATATCCACCCTTCTGG - Intergenic
1117326834 14:54676767-54676789 GTCCAGGATGACAATGCTTTAGG + Intronic
1118149716 14:63176841-63176863 ACCCTGGATGACCACCCTGTAGG + Intergenic
1118634320 14:67733921-67733943 GGCCAAGAGGACAATCCTTTAGG - Exonic
1124596710 15:31097266-31097288 GGCAGGAATCACCACCCTTTGGG + Intronic
1125462507 15:39920308-39920330 GGCCACGCTGACCACCCTGGAGG - Exonic
1129956287 15:79639763-79639785 GGCCAGCATGACCCTCCTTAGGG - Intergenic
1132999164 16:2840594-2840616 GGCCAAGGTGACCACCATATTGG - Intergenic
1133684660 16:8154741-8154763 TGCCAGGATGACCAGACCTTGGG - Intergenic
1137061028 16:35791924-35791946 GGCCAGAATGGCCACAGTTTGGG + Intergenic
1145370578 17:22303498-22303520 GGCCAGGAAGGCCAGCGTTTGGG - Intergenic
1146745282 17:35323490-35323512 GGCCAGTGTGACAGCCCTTTTGG + Intergenic
1147877461 17:43631819-43631841 GGCCAGGATGAGGACCTTTGGGG - Intergenic
1148360900 17:47011088-47011110 GGACAGGATGGCTACCCTTGTGG - Intronic
1152572263 17:81126026-81126048 GGCCAGGATGCCCAGCCCCTGGG - Intronic
1152780067 17:82223373-82223395 GGCCAGGCTGGTCACCCTATTGG + Intergenic
1152857418 17:82673761-82673783 GGCCAGGCTGACCACTCCATGGG + Intronic
1153738468 18:8097796-8097818 GACTAGGATGACCACTGTTTAGG - Intronic
1153921270 18:9792557-9792579 GGCCATGGTTACCACCCTTGAGG - Intronic
1157117067 18:44871844-44871866 GGCCAGGCTCACCAGCCTCTGGG - Intronic
1157560500 18:48642260-48642282 GGCCAGGATGACATCTCTTTGGG - Intronic
1159702010 18:71640746-71640768 GGCCAGTGTGACAGCCCTTTAGG + Intergenic
1160794779 19:940193-940215 GGCCAGGGTGGCCAACTTTTTGG + Intronic
1161089619 19:2353336-2353358 GGCAAGGATGAGCACCATGTTGG - Exonic
1161191660 19:2960729-2960751 GGCCAGGCTGATCACCATGTTGG + Intergenic
1161736605 19:5995543-5995565 GGCCAGGAGTACCACCCTCCTGG + Intronic
1165279547 19:34784524-34784546 AGCCAGGATCACCACCATGTTGG - Intergenic
1166779896 19:45336320-45336342 GGCCAGGAAAACCTTCCTTTAGG - Intronic
1166863920 19:45825048-45825070 GCCCGGGGTGACCACCCTTCGGG + Intronic
925786848 2:7439880-7439902 GGCCAGGAAGACCACTATGTAGG + Intergenic
926358469 2:12063087-12063109 GACCAGTATGACCACAGTTTGGG - Intergenic
929484656 2:42342763-42342785 GGCCAGGAAGAGCATTCTTTAGG - Intronic
932863919 2:75321807-75321829 GGCCTGGAGGACCACCCGTGTGG - Intergenic
934729294 2:96646572-96646594 GGCCAAGATGCCCAGCCTTGAGG - Intergenic
937355071 2:121193048-121193070 GGGCAGAGTGACCACCCATTAGG - Intergenic
938080803 2:128369136-128369158 GGCCAGCATCAGCACCATTTTGG - Intergenic
940911872 2:159216459-159216481 GGCCAGGATGATCAGCTCTTTGG - Intronic
942628609 2:177930961-177930983 AGCCAGGATCACCTCCCCTTGGG + Intronic
943930460 2:193844769-193844791 GGTGAGGATCACCACCCTTTGGG + Intergenic
944232061 2:197406142-197406164 GGCCAGGATTACAGCACTTTGGG + Intronic
1171468970 20:25354606-25354628 GGCCATGATGAGGACCCTTTTGG + Intronic
1171544487 20:25989926-25989948 GGCCAGGAAGGCCAGCTTTTGGG - Intergenic
1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG + Intergenic
1175928314 20:62481421-62481443 GGCCAGGCTCACCGCCCCTTTGG + Intergenic
1181395654 22:22619289-22619311 AGCCAGGATGTCCAACATTTTGG + Intergenic
1181557088 22:23677419-23677441 GGCCAGGAGGGGTACCCTTTGGG - Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182398753 22:30057682-30057704 AGCCACCATGCCCACCCTTTTGG - Intergenic
1183079427 22:35447078-35447100 GGCCAGCAGGACCAGCCTTGGGG - Intergenic
1183145550 22:35988119-35988141 GGCCAAGGTGGCCCCCCTTTAGG - Intronic
1185072264 22:48662808-48662830 GGCCAGGATGGCCCCTCTGTGGG - Intronic
950493883 3:13322302-13322324 GGCCTGGATGACTTCCCTCTGGG + Exonic
951367400 3:21800485-21800507 TGCCAGTATGACCAGCTTTTAGG - Intronic
953908552 3:46880978-46881000 GGCCAGGATGCCCACCCTCGTGG + Intronic
961845257 3:129757469-129757491 AGCCAGGATAGCCACTCTTTAGG - Intronic
964933721 3:162056611-162056633 GGCCAGAATGACAAGCTTTTTGG - Intergenic
966597407 3:181736966-181736988 GGAAAGGAGGCCCACCCTTTTGG - Intergenic
967367270 3:188701491-188701513 GGCCAGGCTGACCTGCCTTACGG - Intronic
974550106 4:63361304-63361326 GGCTTGTATGACCAGCCTTTGGG - Intergenic
975260566 4:72292644-72292666 GTCAATGGTGACCACCCTTTGGG - Intronic
980567291 4:134560155-134560177 TGCCAGGATAACCACTCTATAGG - Intergenic
981800394 4:148648676-148648698 AGCCAGGGTGACCACCTCTTGGG + Intergenic
984649516 4:182255149-182255171 GGCAAGGATGACAGCCCTGTGGG + Intronic
985077495 4:186230986-186231008 GGCCAAGATGACCACCTCTCGGG - Intronic
990476416 5:56165375-56165397 GGCCAGGATGAGCACCAGTGGGG + Intronic
993187741 5:84641769-84641791 GTTCAGGATGAGCACACTTTGGG - Intergenic
995827786 5:116320403-116320425 GGCCATGGTGACCCCCATTTTGG + Intronic
998677926 5:144430437-144430459 GGCCCGGAAGCCAACCCTTTTGG - Intronic
1001973758 5:175979476-175979498 GGCCAGTGTGACAACCCTTCTGG - Intronic
1002243674 5:177864303-177864325 GGCCAGTGTGACAACCCTTCTGG + Intergenic
1009432172 6:63576568-63576590 GTCCAGGATAACCACTCTTATGG - Exonic
1010705964 6:79111140-79111162 GGCCTTGATGGCCACCATTTGGG + Intergenic
1011368699 6:86609223-86609245 GGCCAGGATGACCAGCAGGTTGG - Intergenic
1017650756 6:156579367-156579389 GGCTGGGATGAGCACACTTTTGG - Intergenic
1020317477 7:6916608-6916630 GGGCAGCATAACCACCATTTAGG - Intergenic
1023270543 7:38456882-38456904 TGCCAGGTTGACCAGTCTTTGGG - Intronic
1023865969 7:44238611-44238633 GGCCAGGCTGCTCACCCTGTGGG + Intronic
1024236472 7:47402642-47402664 GGCCAGAAGGACCTCCCTCTGGG - Intronic
1024584278 7:50827513-50827535 GGCCAGGAGGGCCTCCCTTGAGG + Intergenic
1025295869 7:57774991-57775013 GGCCAGGAAGGCCAGCGTTTGGG - Intergenic
1026362764 7:69617900-69617922 TGCCAGAATCACCACCATTTGGG + Intronic
1028506298 7:91574291-91574313 GGCTAGGATGACCCCCCTTTTGG - Intergenic
1035699483 8:1627133-1627155 GGCCAGGATGACCACCCTTTTGG - Intronic
1037390731 8:18388924-18388946 GGTCTTGATGACCACCCTGTGGG + Intergenic
1038547240 8:28435063-28435085 GGCCAGTGTGACAACCTTTTTGG + Intronic
1042671102 8:71264109-71264131 AACCAGGATGATCTCCCTTTTGG - Intronic
1045273546 8:100681871-100681893 GCCCAGGATTTCCACCATTTTGG - Intergenic
1052216449 9:25972250-25972272 GGCCAGGGTGACAGCCTTTTTGG - Intergenic
1053079968 9:35167428-35167450 GACCAGGGTGTCCAACCTTTTGG - Intronic
1053739005 9:41120860-41120882 GGTAAGCATTACCACCCTTTTGG - Intergenic
1057435714 9:95038812-95038834 GGCACTGATGAGCACCCTTTGGG - Intronic
1058798316 9:108519710-108519732 GGTCAGGATGATCTCACTTTGGG - Intergenic
1186747901 X:12588340-12588362 GCCCAGGATTTCCTCCCTTTGGG + Intronic
1187270710 X:17776800-17776822 GGACAGGGTGGGCACCCTTTGGG - Intergenic
1187474882 X:19601987-19602009 GGCCTGGCTGACCACCCAATAGG - Intronic
1187577836 X:20577248-20577270 ACCCAGGATGATCTCCCTTTTGG + Intergenic
1195285372 X:103377543-103377565 GGAGAGGAAGACCGCCCTTTGGG + Exonic
1196731706 X:118947513-118947535 GGCCAGGATAACCACACACTGGG - Intergenic
1196873125 X:120131374-120131396 GGCCAGTGTGACAACCTTTTTGG + Intergenic
1198115638 X:133542371-133542393 AGCCAGGAAGACAAGCCTTTGGG + Intronic