ID: 1035699534

View in Genome Browser
Species Human (GRCh38)
Location 8:1627383-1627405
Sequence GTCCCTGGGCACCACGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035699521_1035699534 23 Left 1035699521 8:1627337-1627359 CCAGGGCAGGACTGATTTCGGGA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG No data
1035699519_1035699534 24 Left 1035699519 8:1627336-1627358 CCCAGGGCAGGACTGATTTCGGG 0: 1
1: 0
2: 1
3: 9
4: 88
Right 1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG No data
1035699516_1035699534 30 Left 1035699516 8:1627330-1627352 CCCACTCCCAGGGCAGGACTGAT 0: 1
1: 0
2: 0
3: 26
4: 197
Right 1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG No data
1035699517_1035699534 29 Left 1035699517 8:1627331-1627353 CCACTCCCAGGGCAGGACTGATT 0: 1
1: 0
2: 0
3: 17
4: 213
Right 1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035699534 Original CRISPR GTCCCTGGGCACCACGGGAG GGG Intronic
No off target data available for this crispr