ID: 1035702146

View in Genome Browser
Species Human (GRCh38)
Location 8:1644260-1644282
Sequence GCTCTTGGTCGGGCGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035702146_1035702154 7 Left 1035702146 8:1644260-1644282 CCTAAGCCCGCCCGACCAAGAGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1035702154 8:1644290-1644312 CGGCTCTGTGCAAGAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035702146 Original CRISPR GCTCTTGGTCGGGCGGGCTT AGG (reversed) Intronic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
901749470 1:11397146-11397168 GCCCCTGGGAGGGCGGGCTTGGG + Intergenic
904047095 1:27615400-27615422 GAGCCTGGTCGGGCGGGATTCGG - Intronic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
918732157 1:188012722-188012744 GCTCCTGGTCTCGCTGGCTTCGG + Intergenic
921925012 1:220704076-220704098 GCTCCTGGTGGGGTGGGCTGAGG - Intergenic
1067480954 10:46597419-46597441 GCTCCTGGTGGGGGGGGGTTGGG - Intergenic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG + Intronic
1077066562 11:643678-643700 GCTCTTGGTCAGGAGGGCAGGGG + Intergenic
1083074150 11:60019637-60019659 GTTCGTGGTCTGGCTGGCTTCGG + Intergenic
1083302447 11:61746067-61746089 TCTCTTGGTCGGGGGAGCCTAGG - Exonic
1084164119 11:67367122-67367144 TCTCTTGCGCGGGCGGGGTTGGG - Intronic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1092336838 12:7640848-7640870 GTTCATGGTCTGGCGGGCTCAGG - Intergenic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1110664692 13:78102780-78102802 GATCTTGGTCATGAGGGCTTAGG + Intergenic
1115303813 14:31913960-31913982 GCTATTGGTCGGGCATGGTTCGG + Intergenic
1127765919 15:62185921-62185943 GCTCGTGGTCTGGCTGGCTCAGG + Intergenic
1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG + Intergenic
1129193501 15:73951308-73951330 GCTCTTGGAAGGAAGGGCTTTGG - Intronic
1131980746 15:97992290-97992312 GCTCAAGGTCAGGTGGGCTTGGG - Intergenic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG + Intergenic
1140190496 16:72811819-72811841 ACTTTTGGGTGGGCGGGCTTGGG - Intronic
1143037320 17:4006868-4006890 GCCCTTGGTGGGGCGTGCATGGG - Exonic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1147998560 17:44374922-44374944 GCTCTGGGAGGGGCGGGGTTTGG - Intronic
1151341358 17:73473070-73473092 GCTTTTGGGCTGGCGGGGTTGGG + Intronic
1158960422 18:62583680-62583702 CCTCTTGGTGGGGTGGGGTTGGG - Intronic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1160231369 18:77052129-77052151 GTTCCTGGTCGGGTGGACTTGGG - Intronic
1160895410 19:1399964-1399986 TCACTAGGTGGGGCGGGCTTAGG + Intronic
1161602569 19:5193481-5193503 GCTCTTTGTCTGGGGGGCTGTGG + Intronic
1161850923 19:6737614-6737636 GCTCATCGGTGGGCGGGCTTGGG - Intergenic
1163125771 19:15243403-15243425 GCTGGGGGCCGGGCGGGCTTGGG + Exonic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1166185653 19:41137212-41137234 GCACGTGGTCGTCCGGGCTTGGG - Intergenic
928080085 2:28303708-28303730 GCTTTTGGTGGGGGGGGCGTTGG - Intronic
932770730 2:74499532-74499554 GTTCATGGTCGGCCGGGCTGGGG + Exonic
934618688 2:95791180-95791202 GCTCTTTGCCGGGCAGGCTTGGG + Intergenic
934642205 2:96033377-96033399 GCTCTTTGCCGGGCAGGCTTGGG - Intronic
1171847882 20:30288770-30288792 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1178407495 21:32336579-32336601 TCTTTTGGTCAGGTGGGCTTTGG - Intronic
1181028310 22:20138088-20138110 GCTCTTGGCCAGGCGGGCGTGGG + Intronic
1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG + Intergenic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG + Intergenic
954198906 3:49012729-49012751 GCTCCTGGTCCCGAGGGCTTCGG + Exonic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
954754797 3:52833336-52833358 ACTCTTGGTGGGTCCGGCTTTGG + Exonic
958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG + Intronic
960282215 3:115792093-115792115 GCTCGTGGTCTCGCTGGCTTCGG - Intergenic
984192672 4:176624446-176624468 GCTCGTGGTCTCGCTGGCTTCGG + Intergenic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
988074540 5:26336126-26336148 GTTCTTGGTCAGGTGGCCTTGGG + Intergenic
1008490169 6:52078151-52078173 GATCGTGGTGGGGCAGGCTTGGG + Intronic
1011974907 6:93283639-93283661 GCTCCTGGTCTCGCTGGCTTCGG - Intronic
1013130016 6:107223761-107223783 GCTCTTGGTGGGTCGGGGTCGGG - Intronic
1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG + Intronic
1033423387 7:141222002-141222024 GCTCTTGGTCTGGAGAGCATTGG + Intronic
1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036566420 8:9942073-9942095 GCTCTTGGTCTGGTGGACTTGGG + Intergenic
1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG + Intergenic
1053786017 9:41653417-41653439 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054174733 9:61867350-61867372 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054662805 9:67713443-67713465 GCTCTTGGTGGGGCTGGGGTTGG + Intergenic
1056733749 9:89186595-89186617 GCACTGGGTCAGGCTGGCTTTGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic