ID: 1035702146

View in Genome Browser
Species Human (GRCh38)
Location 8:1644260-1644282
Sequence GCTCTTGGTCGGGCGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035702146_1035702154 7 Left 1035702146 8:1644260-1644282 CCTAAGCCCGCCCGACCAAGAGC No data
Right 1035702154 8:1644290-1644312 CGGCTCTGTGCAAGAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035702146 Original CRISPR GCTCTTGGTCGGGCGGGCTT AGG (reversed) Intronic