ID: 1035702670

View in Genome Browser
Species Human (GRCh38)
Location 8:1648594-1648616
Sequence GCGAATCCTGCATGCAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035702670_1035702674 1 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702674 8:1648618-1648640 CAAGTCTGCAGACCTTCCCTGGG No data
1035702670_1035702682 19 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702682 8:1648636-1648658 CTGGGGCATGATCAGGACAGGGG No data
1035702670_1035702673 0 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702673 8:1648617-1648639 TCAAGTCTGCAGACCTTCCCTGG No data
1035702670_1035702676 12 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702676 8:1648629-1648651 ACCTTCCCTGGGGCATGATCAGG No data
1035702670_1035702679 17 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702679 8:1648634-1648656 CCCTGGGGCATGATCAGGACAGG No data
1035702670_1035702681 18 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702681 8:1648635-1648657 CCTGGGGCATGATCAGGACAGGG No data
1035702670_1035702675 2 Left 1035702670 8:1648594-1648616 CCCCTTCTGCATGCAGGATTCGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1035702675 8:1648619-1648641 AAGTCTGCAGACCTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035702670 Original CRISPR GCGAATCCTGCATGCAGAAG GGG (reversed) Intronic
901238687 1:7680681-7680703 GCGCATCCCACATGCAGCAGAGG - Intronic
907873390 1:58463645-58463667 GCACATCCTGCATGCATAAATGG + Intronic
911643087 1:100309632-100309654 GCGAAGACTGCATGCACATGAGG + Intergenic
921188495 1:212689642-212689664 GGGAATCATGCAGGCAGCAGAGG + Intronic
921438061 1:215150085-215150107 GGGAACCCTGCATGCAGGAGGGG + Intronic
1065963144 10:30750481-30750503 CCGGATCCTGCAGGCTGAAGGGG + Intergenic
1066373355 10:34836204-34836226 TCGACTCCTGGATGCAGAAAAGG + Intergenic
1072503190 10:96039454-96039476 GGGAATCCTGGAGGAAGAAGGGG + Intergenic
1073970324 10:109040770-109040792 GCGAGTGCTGCATGCAGACCTGG - Intergenic
1074082060 10:110175980-110176002 GCAAATACTGTATGCACAAGTGG - Intergenic
1075943468 10:126411061-126411083 GCCAAGCCTGCAGGTAGAAGTGG - Intergenic
1077362630 11:2147467-2147489 GCCAAAGCTGCTTGCAGAAGGGG + Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1091239893 11:134045359-134045381 GCGAATCCTGCATTCAGCCTGGG + Intergenic
1100819265 12:98416098-98416120 TCGTATCATGGATGCAGAAGAGG - Intergenic
1101963603 12:109267423-109267445 GCCAATCCTGCAGGGGGAAGGGG - Exonic
1102228833 12:111248417-111248439 GTGAGTCCTGCACACAGAAGAGG - Intronic
1103016699 12:117500227-117500249 GAGAAACCGGAATGCAGAAGGGG + Intronic
1104728934 12:131094512-131094534 TCTAATCCTGGAGGCAGAAGAGG + Intronic
1105837424 13:24223559-24223581 GCGCATCCAGCAGGCAGATGCGG - Exonic
1111128479 13:83943152-83943174 GCGAATAATGCATGCAGCCGAGG + Intergenic
1112837178 13:103530382-103530404 TAGAATCCTGGATCCAGAAGTGG + Intergenic
1113053771 13:106244242-106244264 GCTAACCCTCCATGCACAAGTGG + Intergenic
1118571255 14:67197707-67197729 GAGAATCCTGCATGATGAAGAGG + Intronic
1128646206 15:69380581-69380603 GGGAAGCCTGTATGCAGAAATGG + Intronic
1131513023 15:93059946-93059968 GCAACTCCTGCAAGCGGAAGAGG + Intronic
1135928898 16:26719732-26719754 GTGAATCCTGGAGGCAGAACAGG + Intergenic
1136411605 16:30080955-30080977 GTGAGTCCTGGATGCGGAAGAGG + Intronic
1139298670 16:65925421-65925443 GTAAAACCTGCAGGCAGAAGTGG - Intergenic
1140179197 16:72696947-72696969 GCAAATAGTGCATGCAGCAGTGG - Intergenic
1142442134 16:90105804-90105826 GCGGTTGCTGCTTGCAGAAGAGG + Intergenic
1142551448 17:742667-742689 GAAAATCCTGCTTGCAGAAGGGG - Exonic
1147638050 17:41975893-41975915 GTGTCTCCTGCATGCAGAAAGGG + Exonic
1148722896 17:49767497-49767519 TTGAAGCCTGTATGCAGAAGTGG + Intronic
1149654295 17:58302238-58302260 GCCCATCCTGCAGGCAGAAGAGG - Intronic
1153764300 18:8360688-8360710 GGGAACACTGCCTGCAGAAGGGG + Intronic
1160872881 19:1285224-1285246 ACGAATCCTGCAGGCAGGGGAGG - Intergenic
1161171797 19:2815878-2815900 ACAAAACCTGAATGCAGAAGTGG + Intergenic
1163443367 19:17332987-17333009 GCAAATTCTGCAGCCAGAAGCGG + Exonic
1163782442 19:19257587-19257609 GGGAATCCTCTATCCAGAAGAGG + Exonic
1168722814 19:58563498-58563520 GCGAACCCTGCATACACAAGGGG + Exonic
925463139 2:4082473-4082495 GAGAATCCTGCATGCCCAGGCGG - Intergenic
925717384 2:6796845-6796867 CAGAATCCTGCCTGCAGGAGGGG - Intergenic
926385565 2:12332711-12332733 TCCAATCCTGCTTGCTGAAGGGG + Intergenic
935756782 2:106282597-106282619 GCCAAGCCAGCATGCAGGAGGGG + Intergenic
935906017 2:107840828-107840850 GAGAATCCGGGAGGCAGAAGTGG - Intronic
936019638 2:108984907-108984929 CAGAATCCTGCATGCACAGGAGG - Intronic
936029210 2:109058172-109058194 GCTCAACCTGCATGCAGATGGGG - Intergenic
936112786 2:109678428-109678450 GCCAAGCCAGCATGCAGGAGGGG - Intergenic
937810403 2:126193423-126193445 GCCACTACTGCATGGAGAAGGGG + Intergenic
938707183 2:133942403-133942425 CCCAATCCTGCTTCCAGAAGGGG - Intergenic
941577438 2:167250904-167250926 GCGACTCCTGGGTGGAGAAGGGG - Exonic
1169201571 20:3712742-3712764 GGGACTCCAGCAAGCAGAAGTGG + Intergenic
1171402471 20:24884387-24884409 GGGAATCCTGCATGTTGAAATGG + Intergenic
1173727918 20:45309642-45309664 GCGGATCCTGCATGCCAAGGTGG + Exonic
1180910120 22:19444081-19444103 GGGTATCCTGCATGCAGGTGAGG + Exonic
1182868220 22:33623518-33623540 GCCCATCCTGAATGGAGAAGTGG - Intronic
1184456842 22:44615817-44615839 GGGCTTCCAGCATGCAGAAGAGG + Intergenic
1184892480 22:47388525-47388547 GGGACTCCTGCATGCAGACAGGG + Intergenic
968362402 3:198156765-198156787 GCGGTTGCTGCTTGCAGAAGAGG + Intergenic
970887744 4:21006203-21006225 AAGAAACCTGCATGCAGAGGAGG + Intronic
973705182 4:53573858-53573880 GCAAAGCCTGCAGGCAGATGTGG + Exonic
981272548 4:142861457-142861479 GCAAATCCAGCATGCTGATGTGG - Intergenic
985972233 5:3387633-3387655 GCGAATCTTACATGTAAAAGTGG + Intergenic
989183152 5:38598078-38598100 GTGAATCCTGGATGCAGCTGGGG - Intronic
992363821 5:76070933-76070955 GCAACTCCTGCATCCAGAAGAGG - Intergenic
1002365507 5:178706557-178706579 TGGAATCCTGCAAGCAGGAGAGG - Intergenic
1003323101 6:5070256-5070278 GCATATTCTGCTTGCAGAAGAGG - Intergenic
1003488094 6:6596932-6596954 ACGTTTCCTGCCTGCAGAAGAGG - Intronic
1015818388 6:137233936-137233958 CCGAATCCTGCCTGCAGGACAGG - Intergenic
1018174554 6:161167553-161167575 GTGAAGCATGCATGCAGCAGAGG + Intronic
1019163732 6:170085803-170085825 GCGACTCCTGCATGCAAACACGG + Intergenic
1019253278 7:31942-31964 GCGGTTGCTGCTTGCAGAAGAGG - Intergenic
1024053963 7:45647615-45647637 ACGAAGGCTGGATGCAGAAGTGG + Intronic
1024742164 7:52365921-52365943 CCCAATCCTGCAGGCAGAAGGGG + Intergenic
1035702670 8:1648594-1648616 GCGAATCCTGCATGCAGAAGGGG - Intronic
1036295893 8:7537007-7537029 GCGCATTCTGCTTGCGGAAGCGG + Intergenic
1036326673 8:7784012-7784034 GCGCATTCTGCTTGCGGAAGCGG - Intergenic
1037574578 8:20189288-20189310 GTGAATGCTGCATTTAGAAGAGG - Intergenic
1052797026 9:32931908-32931930 GCGCATACTGTATGCAGAAATGG - Intergenic
1056778923 9:89534722-89534744 GCCAGTCCTGCCTGCAGATGAGG + Intergenic
1060089610 9:120731347-120731369 GCCAGTCCTGCATGCAGACCAGG - Intergenic
1062747091 9:138220427-138220449 GCGGTTGCTGCTTGCAGAAGAGG + Intergenic