ID: 1035703230

View in Genome Browser
Species Human (GRCh38)
Location 8:1653279-1653301
Sequence GGTTCTTGGTGCTGGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035703226_1035703230 0 Left 1035703226 8:1653256-1653278 CCTGGAGACACTGGCATTGCATT No data
Right 1035703230 8:1653279-1653301 GGTTCTTGGTGCTGGCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035703230 Original CRISPR GGTTCTTGGTGCTGGCCCTG CGG Intronic