ID: 1035704419

View in Genome Browser
Species Human (GRCh38)
Location 8:1664265-1664287
Sequence TACCCATGCCACCACGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035704419_1035704425 4 Left 1035704419 8:1664265-1664287 CCCTTCCCGTGGTGGCATGGGTA 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1035704425 8:1664292-1664314 TAGGCACAGGCTATGTCCGCTGG No data
1035704419_1035704429 28 Left 1035704419 8:1664265-1664287 CCCTTCCCGTGGTGGCATGGGTA 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1035704429 8:1664316-1664338 CCGTCCTACTCCTGCTTCCCAGG No data
1035704419_1035704424 -9 Left 1035704419 8:1664265-1664287 CCCTTCCCGTGGTGGCATGGGTA 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1035704424 8:1664279-1664301 GCATGGGTACATCTAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035704419 Original CRISPR TACCCATGCCACCACGGGAA GGG (reversed) Intronic
902645490 1:17795077-17795099 GCCCCATGCCACCCCAGGAATGG - Intronic
912171241 1:107101981-107102003 TGCTCATCCCACCAAGGGAACGG + Intergenic
920869904 1:209785322-209785344 GACCCATGCCACGAAGGGAAAGG + Intergenic
923719730 1:236456605-236456627 TGCCTCTGCCACCACAGGAATGG + Intronic
1070497969 10:77041739-77041761 TACCCATGCCCCCACTGGAAGGG - Intronic
1076438739 10:130464551-130464573 TACCCACTCCACCAGAGGAAAGG - Intergenic
1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1079133487 11:17763037-17763059 AACCCCTGCCACCTCGGGATGGG + Intronic
1080248005 11:30201269-30201291 TAGCCATCACACCACGGAAAAGG - Intergenic
1082789071 11:57335128-57335150 TGCCCAGGCCACCACAGGCAGGG - Exonic
1082958539 11:58897323-58897345 TTGCCATGCCACCATGAGAAGGG + Intronic
1082965274 11:58960544-58960566 TTGCCATGCCACCACGAGAAGGG + Intronic
1082974116 11:59055365-59055387 TTGCCATGCCATCACGAGAAGGG + Intergenic
1082978529 11:59099156-59099178 TTGCCATGCCACCACGAGAAGGG + Intergenic
1083394514 11:62380826-62380848 TACCGATGCCACCTGGAGAAGGG - Intronic
1084178549 11:67435567-67435589 TACCCCGCTCACCACGGGAACGG - Exonic
1084203913 11:67579919-67579941 GACCAGTGCCACCAAGGGAAGGG + Intergenic
1087519526 11:99213698-99213720 TACACATGTCACCAAGGCAAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088981821 11:114871141-114871163 TACCTATGCTGCCAGGGGAATGG + Intergenic
1090737130 11:129619746-129619768 TAACCATGCCACCTGGGGAATGG + Intergenic
1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1094027600 12:25975323-25975345 TACCCACCCCACCAGGGTAAAGG + Intronic
1094446056 12:30531791-30531813 CACTCATGCCACTACGTGAACGG + Intergenic
1116648984 14:47565779-47565801 TCCCCATGCCAGCACGGCCATGG - Intronic
1118874958 14:69776259-69776281 AATCCAGGCCACCAGGGGAAGGG + Exonic
1123775570 15:23575751-23575773 CACCCATGCCAGAAAGGGAAGGG - Intronic
1127651173 15:61009238-61009260 TACCCATCCCTCCCCCGGAATGG - Intronic
1133207016 16:4239961-4239983 TGCCCATGCCAGGACGGGGAAGG - Intronic
1137919847 16:52476150-52476172 TACCCATATCACCAGGAGAAAGG + Intronic
1138205124 16:55119018-55119040 GGCCCATGCCACCACATGAAGGG + Intergenic
1147985996 17:44308259-44308281 TCCCCCTGCCGCCAGGGGAAAGG - Intergenic
1151349682 17:73524415-73524437 TCCCCAGCCCACCAGGGGAAGGG - Intronic
1151898190 17:76994530-76994552 TACCGAAGCCACTACCGGAAAGG + Intergenic
1152590744 17:81210703-81210725 TGCCCATGCCACCACAGGATGGG + Intronic
1159203881 18:65225218-65225240 TACCCCTTCCACCATGTGAAGGG + Intergenic
1160535757 18:79590471-79590493 TGCCTCTGCCACCACGGCAACGG + Intergenic
925542008 2:4976609-4976631 TCCCCAGGCCACCATGGGGATGG - Intergenic
930318657 2:49827672-49827694 AACTCATGCCACCAGGGGATAGG - Intergenic
939501025 2:142984720-142984742 TTCCCATGCCCCCAGGTGAAAGG + Intronic
940994883 2:160137679-160137701 TCCAAATGTCACCACGGGAACGG - Exonic
942498751 2:176566039-176566061 AACCCATGGCAACAAGGGAAGGG + Intergenic
946786213 2:223246718-223246740 AACCCATGCCACCAGGGGCTTGG - Intergenic
947207185 2:227672714-227672736 CACCCATGCCACCAAGGTCAGGG + Intergenic
948700621 2:239757501-239757523 GACCCATGCCACCACACGAGAGG + Intergenic
1169944942 20:10978529-10978551 TACCCATGACCACAGGGGAAGGG - Intergenic
1170134838 20:13061438-13061460 TCCACCTGCCACCACGGGACAGG + Intronic
1175816973 20:61888240-61888262 TACCCATGCCACCTTGGTGAGGG - Intronic
949589159 3:5475290-5475312 TACGCATGGCACAAAGGGAAGGG + Intergenic
949734991 3:7161333-7161355 GACCCATGCCACAAAGGGAAAGG - Intronic
950799582 3:15539320-15539342 TTCCCATGTCCCCATGGGAAGGG + Intergenic
952192556 3:31039194-31039216 TACCCCTGCCACCTCTGGTAAGG + Intergenic
956980218 3:74628064-74628086 TTACCATGCAACCAGGGGAATGG + Intergenic
963781139 3:149487739-149487761 TACCCCTTCCACGACGGGTAAGG + Exonic
963980190 3:151528723-151528745 TACCTATGCCACCAGGGCCATGG + Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
968832802 4:2941867-2941889 GGCCCATGCAACCACGGGCAAGG + Intronic
982124134 4:152169773-152169795 TATCCCTGTCTCCACGGGAAGGG - Intergenic
984985582 4:185325935-185325957 TACCCATGCTTCGACTGGAATGG - Intronic
986775054 5:11006639-11006661 TCCTCATGCCTCCACGGAAAGGG - Intronic
992122774 5:73611536-73611558 CACCACTGCCAGCACGGGAAGGG + Intergenic
1000142456 5:158418875-158418897 TTCCCATGCCACTAAGGGACTGG - Intergenic
1003610068 6:7604702-7604724 TACCCATGCCACCAAGCACAGGG - Intronic
1004349163 6:14876046-14876068 AACCAATGACACCACAGGAATGG + Intergenic
1015274048 6:131366323-131366345 TACCCAGGTCCCCATGGGAATGG + Intergenic
1018210207 6:161474124-161474146 AATCCATGCCACCACAGGAGAGG - Intronic
1021093463 7:16509670-16509692 TCACCATGCCACCATGGGAGAGG + Intronic
1024113328 7:46169509-46169531 TAGCCATGAGACCATGGGAAAGG + Intergenic
1029204831 7:98863350-98863372 TAGCCCTGCCACCACGGGAGCGG - Exonic
1035704410 8:1664214-1664236 CACCGATGCCACCACAGGAAGGG - Intronic
1035704419 8:1664265-1664287 TACCCATGCCACCACGGGAAGGG - Intronic
1037223794 8:16558318-16558340 TCCCCATGACAACACGGTAAAGG - Intronic
1038097831 8:24335557-24335579 TTCCCTTGCCATCACGGGAAGGG + Exonic
1039859027 8:41440522-41440544 TACTCACTCCACCAAGGGAATGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1048954959 8:139528252-139528274 TTCCCAAGCCACCACTTGAATGG - Intergenic
1062580033 9:137225342-137225364 GACCAATGCCACCAGGGGAGGGG + Intronic
1190271010 X:48863625-48863647 TACAAATGCCACCAGGGGCAGGG + Intergenic
1194746151 X:97630555-97630577 TACTCATGAGACCATGGGAATGG + Intergenic
1196458063 X:115903685-115903707 TCCCCAAGCAACCACAGGAAGGG + Intergenic
1198924816 X:141777656-141777678 GACTTATGCCACCAGGGGAAAGG - Intergenic
1199547188 X:149018724-149018746 TACACATGCCACCACAAGCAGGG + Intergenic