ID: 1035707937

View in Genome Browser
Species Human (GRCh38)
Location 8:1691614-1691636
Sequence ATTCACTTACCATATTCTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035707937_1035707942 15 Left 1035707937 8:1691614-1691636 CCAACAGAATATGGTAAGTGAAT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1035707942 8:1691652-1691674 GTTCCCTGTAACCAAGCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 77
1035707937_1035707943 16 Left 1035707937 8:1691614-1691636 CCAACAGAATATGGTAAGTGAAT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1035707943 8:1691653-1691675 TTCCCTGTAACCAAGCTAATGGG 0: 1
1: 0
2: 2
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035707937 Original CRISPR ATTCACTTACCATATTCTGT TGG (reversed) Exonic