ID: 1035707937 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:1691614-1691636 |
| Sequence | ATTCACTTACCATATTCTGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 222 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 209} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035707937_1035707942 | 15 | Left | 1035707937 | 8:1691614-1691636 | CCAACAGAATATGGTAAGTGAAT | 0: 1 1: 0 2: 0 3: 12 4: 209 |
||
| Right | 1035707942 | 8:1691652-1691674 | GTTCCCTGTAACCAAGCTAATGG | 0: 1 1: 0 2: 0 3: 8 4: 77 |
||||
| 1035707937_1035707943 | 16 | Left | 1035707937 | 8:1691614-1691636 | CCAACAGAATATGGTAAGTGAAT | 0: 1 1: 0 2: 0 3: 12 4: 209 |
||
| Right | 1035707943 | 8:1691653-1691675 | TTCCCTGTAACCAAGCTAATGGG | 0: 1 1: 0 2: 2 3: 14 4: 143 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035707937 | Original CRISPR | ATTCACTTACCATATTCTGT TGG (reversed) | Exonic | ||