ID: 1035707938

View in Genome Browser
Species Human (GRCh38)
Location 8:1691637-1691659
Sequence CAGGGAACAGGGGTTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035707938_1035707942 -8 Left 1035707938 8:1691637-1691659 CCTCAGTGAACCCCTGTTCCCTG 0: 1
1: 0
2: 2
3: 31
4: 280
Right 1035707942 8:1691652-1691674 GTTCCCTGTAACCAAGCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 77
1035707938_1035707943 -7 Left 1035707938 8:1691637-1691659 CCTCAGTGAACCCCTGTTCCCTG 0: 1
1: 0
2: 2
3: 31
4: 280
Right 1035707943 8:1691653-1691675 TTCCCTGTAACCAAGCTAATGGG 0: 1
1: 0
2: 2
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035707938 Original CRISPR CAGGGAACAGGGGTTCACTG AGG (reversed) Intronic