ID: 1035707942

View in Genome Browser
Species Human (GRCh38)
Location 8:1691652-1691674
Sequence GTTCCCTGTAACCAAGCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035707938_1035707942 -8 Left 1035707938 8:1691637-1691659 CCTCAGTGAACCCCTGTTCCCTG 0: 1
1: 0
2: 2
3: 31
4: 280
Right 1035707942 8:1691652-1691674 GTTCCCTGTAACCAAGCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 77
1035707937_1035707942 15 Left 1035707937 8:1691614-1691636 CCAACAGAATATGGTAAGTGAAT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1035707942 8:1691652-1691674 GTTCCCTGTAACCAAGCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035707942 Original CRISPR GTTCCCTGTAACCAAGCTAA TGG Intronic