ID: 1035710813

View in Genome Browser
Species Human (GRCh38)
Location 8:1712514-1712536
Sequence AGCACTCAAGTCTCTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035710809_1035710813 15 Left 1035710809 8:1712476-1712498 CCTGACGGCTGTGAAGACAACAG No data
Right 1035710813 8:1712514-1712536 AGCACTCAAGTCTCTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035710813 Original CRISPR AGCACTCAAGTCTCTGCTAA GGG Intergenic
No off target data available for this crispr