ID: 1035713348

View in Genome Browser
Species Human (GRCh38)
Location 8:1735305-1735327
Sequence CCAGAGGTGAGATGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035713341_1035713348 11 Left 1035713341 8:1735271-1735293 CCATCTCCATTTGAAACATGACG No data
Right 1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG No data
1035713339_1035713348 19 Left 1035713339 8:1735263-1735285 CCCTCAGGCCATCTCCATTTGAA No data
Right 1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG No data
1035713340_1035713348 18 Left 1035713340 8:1735264-1735286 CCTCAGGCCATCTCCATTTGAAA No data
Right 1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG No data
1035713342_1035713348 5 Left 1035713342 8:1735277-1735299 CCATTTGAAACATGACGAATTGA No data
Right 1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG No data
1035713338_1035713348 30 Left 1035713338 8:1735252-1735274 CCTATGAAATGCCCTCAGGCCAT No data
Right 1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035713348 Original CRISPR CCAGAGGTGAGATGGGAAAC TGG Intergenic
No off target data available for this crispr