ID: 1035713514

View in Genome Browser
Species Human (GRCh38)
Location 8:1736935-1736957
Sequence AAACAGGTATATGTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035713511_1035713514 1 Left 1035713511 8:1736911-1736933 CCTGAGGCTGGATAGTATATGAA No data
Right 1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035713514 Original CRISPR AAACAGGTATATGTGGCTCA TGG Intergenic
No off target data available for this crispr