ID: 1035713611

View in Genome Browser
Species Human (GRCh38)
Location 8:1737471-1737493
Sequence GTGGGAGGTGACTGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035713611_1035713617 -2 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713617 8:1737492-1737514 ACCAGGCCCACCTCCAACACCGG 0: 30
1: 106
2: 216
3: 395
4: 1824
1035713611_1035713627 27 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713627 8:1737521-1737543 CATTTCCACAGGAGATTTGGAGG No data
1035713611_1035713626 24 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713626 8:1737518-1737540 TCACATTTCCACAGGAGATTTGG No data
1035713611_1035713628 28 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713628 8:1737522-1737544 ATTTCCACAGGAGATTTGGAGGG No data
1035713611_1035713619 -1 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713619 8:1737493-1737515 CCAGGCCCACCTCCAACACCGGG 0: 3
1: 27
2: 95
3: 378
4: 2751
1035713611_1035713624 16 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713624 8:1737510-1737532 ACCGGGCGTCACATTTCCACAGG No data
1035713611_1035713629 29 Left 1035713611 8:1737471-1737493 CCCACAACACAGTCACCTCCCAC No data
Right 1035713629 8:1737523-1737545 TTTCCACAGGAGATTTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035713611 Original CRISPR GTGGGAGGTGACTGTGTTGT GGG (reversed) Intergenic
No off target data available for this crispr