ID: 1035714137

View in Genome Browser
Species Human (GRCh38)
Location 8:1740928-1740950
Sequence GGGAAGCCCCATGGTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035714137_1035714144 -7 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714144 8:1740944-1740966 GCTTCCCATTCTTGTGAGGTGGG No data
1035714137_1035714148 -2 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714148 8:1740949-1740971 CCATTCTTGTGAGGTGGGAAGGG No data
1035714137_1035714143 -8 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714143 8:1740943-1740965 GGCTTCCCATTCTTGTGAGGTGG No data
1035714137_1035714146 -3 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714146 8:1740948-1740970 CCCATTCTTGTGAGGTGGGAAGG No data
1035714137_1035714149 2 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035714137 Original CRISPR GGGAAGCCCCATGGTGGGCT GGG (reversed) Intergenic