ID: 1035714140

View in Genome Browser
Species Human (GRCh38)
Location 8:1740934-1740956
Sequence AAGAATGGGAAGCCCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035714140_1035714149 -4 Left 1035714140 8:1740934-1740956 CCACCATGGGGCTTCCCATTCTT No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data
1035714140_1035714148 -8 Left 1035714140 8:1740934-1740956 CCACCATGGGGCTTCCCATTCTT No data
Right 1035714148 8:1740949-1740971 CCATTCTTGTGAGGTGGGAAGGG No data
1035714140_1035714146 -9 Left 1035714140 8:1740934-1740956 CCACCATGGGGCTTCCCATTCTT No data
Right 1035714146 8:1740948-1740970 CCCATTCTTGTGAGGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035714140 Original CRISPR AAGAATGGGAAGCCCCATGG TGG (reversed) Intergenic
No off target data available for this crispr