ID: 1035714143

View in Genome Browser
Species Human (GRCh38)
Location 8:1740943-1740965
Sequence GGCTTCCCATTCTTGTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035714138_1035714143 -9 Left 1035714138 8:1740929-1740951 CCAGCCCACCATGGGGCTTCCCA No data
Right 1035714143 8:1740943-1740965 GGCTTCCCATTCTTGTGAGGTGG No data
1035714137_1035714143 -8 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714143 8:1740943-1740965 GGCTTCCCATTCTTGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035714143 Original CRISPR GGCTTCCCATTCTTGTGAGG TGG Intergenic
No off target data available for this crispr