ID: 1035714148

View in Genome Browser
Species Human (GRCh38)
Location 8:1740949-1740971
Sequence CCATTCTTGTGAGGTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035714140_1035714148 -8 Left 1035714140 8:1740934-1740956 CCACCATGGGGCTTCCCATTCTT No data
Right 1035714148 8:1740949-1740971 CCATTCTTGTGAGGTGGGAAGGG No data
1035714137_1035714148 -2 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714148 8:1740949-1740971 CCATTCTTGTGAGGTGGGAAGGG No data
1035714139_1035714148 -7 Left 1035714139 8:1740933-1740955 CCCACCATGGGGCTTCCCATTCT No data
Right 1035714148 8:1740949-1740971 CCATTCTTGTGAGGTGGGAAGGG No data
1035714138_1035714148 -3 Left 1035714138 8:1740929-1740951 CCAGCCCACCATGGGGCTTCCCA No data
Right 1035714148 8:1740949-1740971 CCATTCTTGTGAGGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035714148 Original CRISPR CCATTCTTGTGAGGTGGGAA GGG Intergenic
No off target data available for this crispr