ID: 1035714149

View in Genome Browser
Species Human (GRCh38)
Location 8:1740953-1740975
Sequence TCTTGTGAGGTGGGAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035714138_1035714149 1 Left 1035714138 8:1740929-1740951 CCAGCCCACCATGGGGCTTCCCA No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data
1035714137_1035714149 2 Left 1035714137 8:1740928-1740950 CCCAGCCCACCATGGGGCTTCCC No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data
1035714141_1035714149 -7 Left 1035714141 8:1740937-1740959 CCATGGGGCTTCCCATTCTTGTG No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data
1035714139_1035714149 -3 Left 1035714139 8:1740933-1740955 CCCACCATGGGGCTTCCCATTCT No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data
1035714140_1035714149 -4 Left 1035714140 8:1740934-1740956 CCACCATGGGGCTTCCCATTCTT No data
Right 1035714149 8:1740953-1740975 TCTTGTGAGGTGGGAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035714149 Original CRISPR TCTTGTGAGGTGGGAAGGGC AGG Intergenic
No off target data available for this crispr