ID: 1035718882

View in Genome Browser
Species Human (GRCh38)
Location 8:1775903-1775925
Sequence ATTCTCAGTCTTCCGTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035718879_1035718882 3 Left 1035718879 8:1775877-1775899 CCAGGTGCCGGGTCATAACAAAG No data
Right 1035718882 8:1775903-1775925 ATTCTCAGTCTTCCGTAAGTGGG No data
1035718878_1035718882 9 Left 1035718878 8:1775871-1775893 CCTGTGCCAGGTGCCGGGTCATA No data
Right 1035718882 8:1775903-1775925 ATTCTCAGTCTTCCGTAAGTGGG No data
1035718880_1035718882 -4 Left 1035718880 8:1775884-1775906 CCGGGTCATAACAAAGACGATTC No data
Right 1035718882 8:1775903-1775925 ATTCTCAGTCTTCCGTAAGTGGG No data
1035718877_1035718882 10 Left 1035718877 8:1775870-1775892 CCCTGTGCCAGGTGCCGGGTCAT No data
Right 1035718882 8:1775903-1775925 ATTCTCAGTCTTCCGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035718882 Original CRISPR ATTCTCAGTCTTCCGTAAGT GGG Intronic