ID: 1035721068

View in Genome Browser
Species Human (GRCh38)
Location 8:1792398-1792420
Sequence TAGATTAGTTAACCTGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035721067_1035721068 0 Left 1035721067 8:1792375-1792397 CCTTTCTAGTTTATTTTTCTACT No data
Right 1035721068 8:1792398-1792420 TAGATTAGTTAACCTGTTCTAGG No data
1035721066_1035721068 1 Left 1035721066 8:1792374-1792396 CCCTTTCTAGTTTATTTTTCTAC No data
Right 1035721068 8:1792398-1792420 TAGATTAGTTAACCTGTTCTAGG No data
1035721065_1035721068 24 Left 1035721065 8:1792351-1792373 CCTTTTACATTTAGGTCTTTGAT No data
Right 1035721068 8:1792398-1792420 TAGATTAGTTAACCTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035721068 Original CRISPR TAGATTAGTTAACCTGTTCT AGG Intergenic
No off target data available for this crispr