ID: 1035725051

View in Genome Browser
Species Human (GRCh38)
Location 8:1819060-1819082
Sequence CCTATTTGATGATAGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035725040_1035725051 22 Left 1035725040 8:1819015-1819037 CCCATGTTCATCCATATAGTGGT No data
Right 1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG No data
1035725043_1035725051 11 Left 1035725043 8:1819026-1819048 CCATATAGTGGTAAAAGAGGCAG No data
Right 1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG No data
1035725041_1035725051 21 Left 1035725041 8:1819016-1819038 CCATGTTCATCCATATAGTGGTA No data
Right 1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035725051 Original CRISPR CCTATTTGATGATAGAGCCC AGG Intergenic
No off target data available for this crispr