ID: 1035725838

View in Genome Browser
Species Human (GRCh38)
Location 8:1824312-1824334
Sequence GCCCCTCAGGATAACGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035725818_1035725838 15 Left 1035725818 8:1824274-1824296 CCTCCCCCCGAGCAGCTCCCCCT 0: 1
1: 0
2: 1
3: 31
4: 398
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725822_1035725838 9 Left 1035725822 8:1824280-1824302 CCCGAGCAGCTCCCCCTTCCGCG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725815_1035725838 18 Left 1035725815 8:1824271-1824293 CCCCCTCCCCCCGAGCAGCTCCC 0: 1
1: 0
2: 4
3: 75
4: 762
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725827_1035725838 -3 Left 1035725827 8:1824292-1824314 CCCCTTCCGCGGCGCCCCCGGCC 0: 1
1: 1
2: 1
3: 34
4: 421
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725828_1035725838 -4 Left 1035725828 8:1824293-1824315 CCCTTCCGCGGCGCCCCCGGCCC 0: 1
1: 0
2: 1
3: 52
4: 336
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725823_1035725838 8 Left 1035725823 8:1824281-1824303 CCGAGCAGCTCCCCCTTCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 191
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725821_1035725838 10 Left 1035725821 8:1824279-1824301 CCCCGAGCAGCTCCCCCTTCCGC 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725829_1035725838 -5 Left 1035725829 8:1824294-1824316 CCTTCCGCGGCGCCCCCGGCCCC 0: 1
1: 1
2: 8
3: 119
4: 835
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725819_1035725838 12 Left 1035725819 8:1824277-1824299 CCCCCCGAGCAGCTCCCCCTTCC 0: 1
1: 0
2: 2
3: 33
4: 594
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725826_1035725838 -2 Left 1035725826 8:1824291-1824313 CCCCCTTCCGCGGCGCCCCCGGC 0: 1
1: 0
2: 4
3: 42
4: 347
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725820_1035725838 11 Left 1035725820 8:1824278-1824300 CCCCCGAGCAGCTCCCCCTTCCG 0: 1
1: 0
2: 0
3: 25
4: 304
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725830_1035725838 -9 Left 1035725830 8:1824298-1824320 CCGCGGCGCCCCCGGCCCCTCAG 0: 1
1: 0
2: 1
3: 62
4: 519
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725817_1035725838 16 Left 1035725817 8:1824273-1824295 CCCTCCCCCCGAGCAGCTCCCCC 0: 1
1: 0
2: 3
3: 37
4: 483
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1035725816_1035725838 17 Left 1035725816 8:1824272-1824294 CCCCTCCCCCCGAGCAGCTCCCC 0: 1
1: 0
2: 4
3: 54
4: 502
Right 1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035725838 Original CRISPR GCCCCTCAGGATAACGGCGC GGG Intronic
901405156 1:9040262-9040284 CCCACTCAGGATGACGGGGCTGG - Intronic
902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG + Intergenic
902807148 1:18868195-18868217 GCCCCCCTGGATGACGGAGCAGG - Intronic
922770036 1:228176694-228176716 GCCCCCCAGGATGGCGGCACAGG - Exonic
923041382 1:230322337-230322359 GCCCCTCAGAACAACAGGGCTGG - Intronic
1067213550 10:44281704-44281726 GCCCCTGAGGACAAGGGTGCTGG + Intergenic
1083859284 11:65411404-65411426 GCCCCTCAGGAGGACAGTGCCGG - Exonic
1084659443 11:70538334-70538356 GCCCCTCGGGACAAAGGCGGTGG - Intronic
1089563546 11:119358043-119358065 TCACCTCAGGATAACCTCGCTGG + Exonic
1089640620 11:119845084-119845106 CCCCCTCAGGCTAAGGGCTCAGG - Intergenic
1090829964 11:130414498-130414520 GCCCCTGAGGATAGCGGGGAGGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1093317728 12:17671561-17671583 GCCCCTCAGCTTAACAGCACAGG + Intergenic
1096814563 12:54193735-54193757 GTCCCTCAGGATAATTGCTCTGG - Intergenic
1101471188 12:104998844-104998866 GCCACTCAGGGTAAGGGGGCGGG + Intronic
1121310588 14:92933225-92933247 GCCCATGAGGGTAACGGGGCAGG + Intronic
1139513453 16:67440162-67440184 GCCCCTCAGCATCACAGAGCAGG + Intronic
1157335873 18:46736966-46736988 GTCCCTCAGGAGAACAGCTCAGG - Intronic
1157354104 18:46917497-46917519 GCCCGTCACGTGAACGGCGCGGG + Intronic
1164387988 19:27793432-27793454 GCCCCTCAGGAGGAAGGGGCGGG + Intergenic
1165750537 19:38256602-38256624 GCCCCACAGGATCCCGGCCCGGG - Intronic
929813356 2:45211040-45211062 GCCCCTGAGGATATCGGAGGAGG + Intergenic
932475441 2:72003074-72003096 ACCCCTCATGTTAACGGGGCAGG + Intergenic
1169186059 20:3618172-3618194 CACCCTCAGGATAATGGCACAGG + Intronic
1185199073 22:49491078-49491100 GCCCCTCAGGACACCGGTCCTGG - Intronic
949351198 3:3126723-3126745 GGCCCTGAGGAAACCGGCGCGGG - Intergenic
968002241 3:195214109-195214131 ACCCCTCAGGCAAACGGGGCTGG - Intronic
1012335888 6:98057039-98057061 GCCCCTCAGGACAAGGGCAGAGG + Intergenic
1035725838 8:1824312-1824334 GCCCCTCAGGATAACGGCGCGGG + Intronic
1041644421 8:60237092-60237114 GCCTCTCAGAATAATGGAGCTGG - Intronic
1046528446 8:115412784-115412806 GCTCCTCAGCATAACTGCTCAGG - Exonic
1050612377 9:7366500-7366522 GACCCTCAGGAAAAGGGCACTGG + Intergenic
1056950155 9:91035324-91035346 GCCCCTCAGGAAGACAGCACAGG - Intergenic
1060076393 9:120594225-120594247 GCCCCTCAAGATGAGGGTGCTGG - Intergenic
1203772988 EBV:58868-58890 GCCCCTCAGGACCACGGAGCTGG + Intergenic