ID: 1035726727

View in Genome Browser
Species Human (GRCh38)
Location 8:1829368-1829390
Sequence AGGGCAACCGCCCACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035726727_1035726739 15 Left 1035726727 8:1829368-1829390 CCAGGCCTGTGGGCGGTTGCCCT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data
1035726727_1035726736 10 Left 1035726727 8:1829368-1829390 CCAGGCCTGTGGGCGGTTGCCCT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1035726736 8:1829401-1829423 GGCCAGCTTGAAGTCCGCTGAGG No data
1035726727_1035726737 11 Left 1035726727 8:1829368-1829390 CCAGGCCTGTGGGCGGTTGCCCT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1035726737 8:1829402-1829424 GCCAGCTTGAAGTCCGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035726727 Original CRISPR AGGGCAACCGCCCACAGGCC TGG (reversed) Intronic
900302694 1:1985934-1985956 TGGGCAACCGCCCACCGCCCGGG - Intronic
900553188 1:3266816-3266838 CAGGCAACCGCCCCCACGCCCGG + Intronic
900585669 1:3431238-3431260 AGGGCCTCCACACACAGGCCAGG + Intronic
901426066 1:9182950-9182972 ACGGCCACCGCCCGCCGGCCCGG + Intergenic
903009649 1:20320560-20320582 AGGGCAGCCAGCCCCAGGCCTGG - Intronic
904090991 1:27945074-27945096 AGAGAAAAGGCCCACAGGCCTGG - Intronic
905462770 1:38132346-38132368 AGGGCATCTTCCCATAGGCCAGG + Intergenic
908256819 1:62309933-62309955 AAGGCGGCCACCCACAGGCCTGG + Intronic
909516346 1:76511460-76511482 AGGGGCACCGCACACAGGCTAGG - Intronic
910127639 1:83861002-83861024 ACGGGAACTGCGCACAGGCCGGG + Intergenic
918055703 1:181020018-181020040 AGGGCACCCGCCACCACGCCCGG - Intronic
918410663 1:184254995-184255017 TGGTCAACCTCCCACAGCCCGGG - Intergenic
918953639 1:191175256-191175278 AAGGCAACCCCCCACTGGCAAGG + Intergenic
919292767 1:195654123-195654145 CAGGCACCCGCCCACATGCCCGG + Intergenic
922991835 1:229920851-229920873 AGGCCCAGGGCCCACAGGCCTGG + Intergenic
924256198 1:242185255-242185277 ATGGGAACCTACCACAGGCCAGG + Intronic
1063241948 10:4179581-4179603 TAGGCAACCGCCACCAGGCCTGG - Intergenic
1063838153 10:10040140-10040162 AGGTCAACCCCCCACATGACTGG - Intergenic
1066566467 10:36726853-36726875 CGGGCAACCGCCACCACGCCTGG + Intergenic
1067473492 10:46551913-46551935 AGGGGAGCAGGCCACAGGCCAGG - Intronic
1069748075 10:70728618-70728640 AGGGCACTGGCCCACAGTCCTGG + Intronic
1070895877 10:79982514-79982536 GGGGCTCCCGCCCACCGGCCTGG - Intronic
1072253719 10:93601178-93601200 AGGGGAACCGCGCGCAAGCCTGG + Intronic
1075438218 10:122460606-122460628 AGGACTACTGCCCACAGGCCTGG + Intergenic
1076573160 10:131445754-131445776 AGGGCACCCGCCCACCTGCACGG - Intergenic
1077486919 11:2843117-2843139 AGGGCAGCTGCCCCAAGGCCTGG + Intronic
1081045976 11:38273587-38273609 AAGGCACCCGCCACCAGGCCCGG + Intergenic
1082026795 11:47578620-47578642 AGTCCATCCGCCCCCAGGCCGGG + Intronic
1083827519 11:65211821-65211843 AGGCCGACCGCCCACAGGCTGGG - Exonic
1083897199 11:65625825-65625847 AGGGCCACCTGGCACAGGCCGGG - Intronic
1086804211 11:91219655-91219677 ATAGCAAACGCCCACATGCCTGG + Intergenic
1087709168 11:101530031-101530053 AGGTCCACCACCCACAGGCCTGG + Intronic
1088598295 11:111455813-111455835 AGGGCCACCGCCTGAAGGCCTGG + Exonic
1089561004 11:119343057-119343079 ACTGCAGCCTCCCACAGGCCTGG + Intronic
1090024509 11:123156204-123156226 AAGGCAACCATCCACAAGCCAGG + Intronic
1092124027 12:6063340-6063362 AGGGCACCTGCCTACAGCCCAGG - Intronic
1095084704 12:38048875-38048897 AGGCCACCTGCCCACAGCCCAGG - Intergenic
1095820205 12:46470174-46470196 AAGGCAGCTGCCCACAAGCCAGG + Intergenic
1095964665 12:47858739-47858761 AGGGCATCTGCCCACAGAACTGG + Intronic
1098268367 12:68746314-68746336 AGGGCAGCCGGAGACAGGCCCGG + Exonic
1100552380 12:95656959-95656981 CAGGCAACCGCCAACACGCCCGG - Intergenic
1103394786 12:120599233-120599255 AGGGCAGTGGCCCACAGGCAGGG - Intergenic
1104905570 12:132211882-132211904 TGGGCCACAGCCCACAGGCGTGG - Intronic
1107912041 13:45114579-45114601 AGGGCACCCGCCACCAGGCCCGG - Intergenic
1107935766 13:45343883-45343905 CAGGCAACCGCCAACAGGCTCGG - Intergenic
1113789374 13:113019453-113019475 AGGGCAAACCCCCACGGGCAGGG - Intronic
1113800955 13:113085993-113086015 AGGGCAGCTCCCCACAGACCAGG + Intronic
1113985840 13:114314797-114314819 AGGGCCCGCCCCCACAGGCCGGG + Intronic
1114305189 14:21416955-21416977 AAGGCATCCGCCACCAGGCCCGG - Intronic
1119080040 14:71684438-71684460 AGGGCGTCCGGCCAAAGGCCTGG - Intronic
1121124233 14:91395683-91395705 AGGCCACCAGCCCCCAGGCCAGG + Intronic
1121310725 14:92933753-92933775 AGGGCATCTGCCCACGTGCCTGG + Intronic
1122290519 14:100678274-100678296 AGGGCCTCTTCCCACAGGCCTGG + Intergenic
1122793161 14:104192921-104192943 AGGCCAACCAGCCACAGGCAGGG - Intergenic
1126494600 15:49277103-49277125 AGGGCGCCCGCCAACACGCCCGG + Intronic
1129078688 15:73020615-73020637 AAGGCAACTGTCTACAGGCCAGG + Intergenic
1130515998 15:84626073-84626095 AGTGCAAGGGCCCACAGGCAGGG - Intronic
1132567771 16:631142-631164 GGGGGCACCGACCACAGGCCCGG + Exonic
1132652563 16:1028267-1028289 AGGGCACACGCCCACACGCATGG + Intergenic
1136007657 16:27341986-27342008 AGGGCCAGCGCCCACAGAGCTGG - Intronic
1137321718 16:47390600-47390622 AGGGCACCCGCCACCACGCCCGG + Intronic
1141543699 16:84747848-84747870 TGGGCCACCGCACTCAGGCCAGG + Intronic
1142126808 16:88414516-88414538 AGGGCAGAGGCCCCCAGGCCCGG + Intergenic
1143674813 17:8424642-8424664 CGGGCACCCGCCAACATGCCTGG + Intronic
1144955599 17:19017453-19017475 AGACCAACAGCCCAGAGGCCTGG + Intronic
1146499153 17:33349481-33349503 AGGGCATCAGCCCACATGCCTGG - Intronic
1147732521 17:42612900-42612922 AGGGCAACAGACCGAAGGCCTGG - Intronic
1148323274 17:46770083-46770105 AGGGCAGGCGCTCCCAGGCCGGG - Intronic
1149902282 17:60491585-60491607 CAGGCACCCGCCAACAGGCCCGG + Intronic
1152893921 17:82898971-82898993 AGGGCAGCAGCACACAGGCTGGG - Intronic
1154996672 18:21646988-21647010 CAGGCATCCGCCAACAGGCCAGG - Intergenic
1157293278 18:46424986-46425008 AGGACAGCCGGCCACAGGGCTGG - Intronic
1157814708 18:50722230-50722252 AGGGCAAAGGCCCACTGGCAGGG - Intronic
1158931656 18:62329275-62329297 AGGGCATCTGCCCCCTGGCCAGG + Intronic
1160806961 19:996165-996187 AGGGCAGCCGACCTCAGCCCCGG - Intronic
1161060101 19:2210541-2210563 AGGGCACCCGCCCCCTGCCCGGG + Intronic
1161064893 19:2232752-2232774 AGGGCACCAGGCCACAGGCAAGG + Intronic
1161066298 19:2240059-2240081 AGGTCAACTGCCCAGTGGCCTGG + Intronic
1162300779 19:9843650-9843672 AGGGCAGCCGTCTACAAGCCAGG - Intronic
1163233609 19:16019198-16019220 TGGACAACTGCCCACAGGCTGGG - Intergenic
1164635142 19:29786229-29786251 ATGGACACTGCCCACAGGCCAGG + Intergenic
1164686641 19:30170586-30170608 AAGGCAGCCGTCCACAAGCCGGG + Intergenic
1167030137 19:46953421-46953443 AGTGCAAACGTCCAGAGGCCAGG + Intronic
927240507 2:20916303-20916325 AGGGCACCTCCCCACATGCCAGG - Intergenic
928433258 2:31237545-31237567 CGGGCACCCGCCAACACGCCTGG + Intronic
929534272 2:42770633-42770655 AGGGCAGCCCCACTCAGGCCTGG + Intronic
931515017 2:63045274-63045296 GGGGCAGCCTCCCACTGGCCTGG + Intronic
932417350 2:71581480-71581502 AGGGAAACCCCACACAGGCCAGG - Intronic
932593193 2:73079415-73079437 AAGGCAGCCCCCCACAAGCCAGG - Intronic
934546201 2:95218765-95218787 AGGGCAACCATCTACAAGCCAGG - Intronic
934670231 2:96208062-96208084 AGGGCCAACGACCACAGGGCAGG + Intronic
934710236 2:96509585-96509607 AGCGGAACTGACCACAGGCCTGG + Intergenic
936241361 2:110791011-110791033 TGGGCCCCAGCCCACAGGCCAGG - Intronic
936933910 2:117819233-117819255 AGGGCAACAACCCACTTGCCTGG - Intronic
937097965 2:119248003-119248025 AGGGCAGCCGCCAGCACGCCGGG - Exonic
937377617 2:121348461-121348483 TAGGCAACCCCACACAGGCCGGG + Intronic
942347411 2:175017862-175017884 AGGGCAGCAGCACCCAGGCCTGG - Intergenic
944209649 2:197193737-197193759 CGGGCGACCGCCACCAGGCCCGG - Intronic
946009844 2:216555575-216555597 AGGACAGCGGCCCCCAGGCCTGG - Intronic
946361590 2:219222297-219222319 CGGGCAGGCGCCCACAGGCCGGG - Exonic
947178075 2:227387653-227387675 AGGGCACCTGCCCAGAGGCTGGG + Intergenic
948929418 2:241122586-241122608 CCGGAAACCGCCCACATGCCAGG + Intronic
1172421877 20:34825238-34825260 AGCGCCCCCGCCCGCAGGCCTGG + Intronic
1175226626 20:57448244-57448266 AGTGCACACGTCCACAGGCCTGG + Intergenic
1175588805 20:60170381-60170403 AAGGCACCCGTCCACAAGCCAGG + Intergenic
1178992295 21:37366438-37366460 CGGGCGATCGCGCACAGGCCTGG + Intronic
1180132578 21:45835888-45835910 AGGGGAACAGGCCCCAGGCCTGG + Intronic
1180968776 22:19804068-19804090 AGGGCAAGCCCCTCCAGGCCAGG - Intronic
1181158193 22:20938499-20938521 ATGGCAACAGCCCACTGCCCTGG - Intronic
1183252423 22:36739538-36739560 ATGGCAGCCGCTCAAAGGCCAGG + Intergenic
1184230119 22:43154111-43154133 AGTGAAACAGCCCACAGGTCTGG - Intronic
1184782969 22:46658329-46658351 GGGGCAGCCGCACACAGGCCAGG - Intronic
954218656 3:49138864-49138886 CAGGCAACCGCCAACATGCCTGG + Intergenic
954330449 3:49887220-49887242 AGGGCCACTGCCCTCTGGCCTGG + Exonic
960960594 3:123067691-123067713 TGGGCCTCCGCCCACAGGCCAGG + Intronic
961477719 3:127159030-127159052 AGGGCTGCAGCCCACAGCCCAGG + Intergenic
962940873 3:140123719-140123741 AAGGCAAACATCCACAGGCCAGG - Intronic
963160972 3:142149955-142149977 AGGGCGACCCCGCAAAGGCCTGG - Intergenic
968937521 4:3619887-3619909 AAGGCGGCCGCCCACAGCCCAGG - Intergenic
969503125 4:7566630-7566652 GGGGGGACCACCCACAGGCCTGG - Intronic
973650629 4:52994047-52994069 GGGGTAACTCCCCACAGGCCAGG + Intronic
984795764 4:183659012-183659034 AAGGCAGCGGCCCAGAGGCCGGG + Exonic
985040448 4:185886410-185886432 AAGGCAACCGCCACCATGCCCGG - Intronic
985533197 5:445765-445787 GGTGCAGCTGCCCACAGGCCTGG + Intronic
985869356 5:2542117-2542139 AGCGAAAGCGCCCACAGGCAAGG + Intergenic
985921751 5:2983008-2983030 GGAGCAACTGCCCACAGGCTAGG - Intergenic
991987293 5:72302255-72302277 AGTGCAATGGCCCACAAGCCTGG + Intronic
994830472 5:104775189-104775211 AGGGCCCCCGCCCTCAAGCCTGG - Intergenic
995347258 5:111135114-111135136 AGGGCCACCCCCCAGGGGCCTGG + Intergenic
997607110 5:135182917-135182939 AGGTCCACAGCCCAGAGGCCCGG - Intronic
999045073 5:148458671-148458693 AGAGCAAAGGCCCACAGTCCTGG + Intronic
1002044620 5:176534976-176534998 AGAGCAGACACCCACAGGCCTGG - Intronic
1002314360 5:178333677-178333699 AGGGCCTCTGCCCCCAGGCCGGG + Intronic
1002333436 5:178461331-178461353 AGGCCCATCACCCACAGGCCTGG + Intronic
1002583289 5:180223811-180223833 AAGGCAGCCGTCCACAAGCCAGG - Intergenic
1003171887 6:3726632-3726654 AGCCCTGCCGCCCACAGGCCCGG + Intronic
1003623270 6:7721012-7721034 AGGGGAAGAGGCCACAGGCCAGG - Intergenic
1004872586 6:19922386-19922408 AGGACAGCTGCCCACAGCCCAGG - Intergenic
1005436407 6:25816556-25816578 AGGGCAAGCGCCCTCTGGCCTGG + Intronic
1006010742 6:31041054-31041076 AGTGCAGCCACCCACAGTCCCGG + Intergenic
1006184369 6:32172167-32172189 AAGGCATGCGCCAACAGGCCCGG - Intronic
1006603798 6:35242685-35242707 AGGGCAAGGGCCGACGGGCCCGG + Exonic
1010694547 6:78954242-78954264 CAGGCACCCGCCCACACGCCTGG + Intronic
1013317278 6:108954964-108954986 AGGGCAATCAACCACATGCCAGG - Intronic
1019056345 6:169226154-169226176 AGGGCAGCCGCAGACAGGCGGGG - Intronic
1021735018 7:23634546-23634568 AGGGCAACCAGCCACAGTACTGG - Intronic
1023407863 7:39855116-39855138 AAGGCAGCGGCCCAGAGGCCGGG + Intergenic
1023925360 7:44665130-44665152 AGGGCAATTGCCCAAAAGCCAGG + Intronic
1023995362 7:45156255-45156277 AGGCCTTCTGCCCACAGGCCAGG - Intergenic
1026875534 7:73877128-73877150 TGGGCCAGCCCCCACAGGCCAGG - Intergenic
1027126455 7:75559938-75559960 AGGCCAACCGCCCACTGCCACGG + Intronic
1027132200 7:75599065-75599087 GGGGCAACCCTGCACAGGCCAGG - Intronic
1029229831 7:99057451-99057473 AGAGCAGCCGCACACAGCCCAGG + Exonic
1029692218 7:102190036-102190058 AGGGCAAACGCCCACAGTGGTGG - Intronic
1030023757 7:105301437-105301459 AGGGCAGCGGCCCAGAGGCCCGG - Intronic
1031991217 7:128200537-128200559 AGGGCAAAGGCCCAGAGGCAAGG + Intergenic
1033485794 7:141787808-141787830 AGGGCAGCCGCCAACATGGCTGG - Intronic
1034163585 7:149009612-149009634 AGGGCACCCTACCACAGGGCTGG + Intronic
1034345444 7:150382629-150382651 TGGGCCAGAGCCCACAGGCCAGG + Intronic
1035684651 8:1514316-1514338 AGGGTAACCCCCAACAGCCCAGG + Intronic
1035726727 8:1829368-1829390 AGGGCAACCGCCCACAGGCCTGG - Intronic
1037935167 8:22910587-22910609 AGGGCAACTGCCCAATGGCTTGG + Intronic
1037987101 8:23296792-23296814 AGGGCATCCGTTCACAGGACAGG - Intergenic
1049066340 8:140319316-140319338 CGGGCACCCGCCACCAGGCCTGG + Intronic
1049309022 8:141923599-141923621 AGGGTAACCTCCCACAAGCAGGG + Intergenic
1054790346 9:69250870-69250892 AGGGCAAACAGCCACTGGCCAGG - Intronic
1057406334 9:94774167-94774189 CAGGCAACCGCCCCCACGCCCGG - Intronic
1057547042 9:96026486-96026508 ACTGCCAACGCCCACAGGCCAGG + Intergenic
1057664703 9:97036211-97036233 CGGGCACCCGCCACCAGGCCGGG + Intronic
1057900647 9:98945361-98945383 AGGGCAAGAGCCTACAGACCTGG - Intronic
1061496482 9:130977774-130977796 AGGGCAGCCACCCCAAGGCCCGG + Intergenic
1062064430 9:134518484-134518506 AGCACAGCCGCCCGCAGGCCAGG - Intergenic
1062273819 9:135721435-135721457 AGAGCAAACACCCACAGGCTTGG + Intronic
1062274224 9:135723212-135723234 AGGGCAGCACCCCAGAGGCCTGG + Intronic
1062391507 9:136335800-136335822 TGGGCAGGGGCCCACAGGCCGGG - Intronic
1062437791 9:136554307-136554329 AAGGGACCAGCCCACAGGCCTGG - Intergenic
1191740989 X:64434846-64434868 AGGGCACCCCCCCCCCGGCCAGG - Intergenic
1201247387 Y:12018747-12018769 AGGGCAACCTCCCAGAGGGAGGG - Intergenic