ID: 1035726728

View in Genome Browser
Species Human (GRCh38)
Location 8:1829373-1829395
Sequence CACACAGGGCAACCGCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035726728_1035726737 6 Left 1035726728 8:1829373-1829395 CCTGTGGGCGGTTGCCCTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1035726737 8:1829402-1829424 GCCAGCTTGAAGTCCGCTGAGGG No data
1035726728_1035726739 10 Left 1035726728 8:1829373-1829395 CCTGTGGGCGGTTGCCCTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data
1035726728_1035726741 29 Left 1035726728 8:1829373-1829395 CCTGTGGGCGGTTGCCCTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1035726741 8:1829425-1829447 CTGGAGCCAGCCCCTGACCCTGG No data
1035726728_1035726736 5 Left 1035726728 8:1829373-1829395 CCTGTGGGCGGTTGCCCTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1035726736 8:1829401-1829423 GGCCAGCTTGAAGTCCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035726728 Original CRISPR CACACAGGGCAACCGCCCAC AGG (reversed) Intronic
900390335 1:2431116-2431138 CACGCAGGGCAGCCAGCCACAGG - Intronic
902372820 1:16016499-16016521 CACACACAGCGCCCGCCCACAGG - Intronic
903995170 1:27300946-27300968 CACAGAGTGCAACTGCACACTGG - Intronic
905794978 1:40810656-40810678 GACACTGGGCAAACGCCCAGTGG + Intronic
907570239 1:55476590-55476612 CACACAGGGCAAAGGCCCTGGGG + Intergenic
910993468 1:93079449-93079471 CTCGCAGGGGAAGCGCCCACGGG + Exonic
916568045 1:165998796-165998818 CAGACAAGCCAACCTCCCACTGG - Intergenic
922356795 1:224784011-224784033 CACACAGGGCTAAAGCCCATTGG + Intergenic
922883050 1:228997076-228997098 CACACAGGACATCCGCCCTGAGG - Intergenic
1063907138 10:10792686-10792708 CACACAGGGCTCACACCCACAGG - Intergenic
1064366875 10:14716351-14716373 CTCACAGGGCAGCTGCTCACCGG + Intronic
1070708099 10:78656450-78656472 CCCAGAGGGCAACGCCCCACCGG + Intergenic
1072210809 10:93245282-93245304 CACACAGCCCAGCCTCCCACCGG - Intergenic
1075381676 10:122023927-122023949 CCCACAAGGCAATCACCCACTGG - Intronic
1076117893 10:127913201-127913223 CACACAAGGCAAGGGCCCAGGGG + Intronic
1076747213 10:132520339-132520361 CACACAGGCCAGACGCACACAGG + Intergenic
1077755653 11:5025111-5025133 CAAAGATGGCAACCTCCCACTGG - Intergenic
1079205652 11:18412324-18412346 CACGGAGGGCAACCGTCGACGGG + Exonic
1085663867 11:78395034-78395056 CACACTGGGCAACTGGGCACTGG + Intronic
1091556454 12:1577179-1577201 CACACAGGGCAGGCCCCCAGAGG - Intronic
1093583216 12:20807483-20807505 CACACACGGCAACGCACCACGGG - Intergenic
1096241694 12:49963167-49963189 CAAACCGGGCAGCTGCCCACAGG + Intronic
1099380279 12:81944607-81944629 CACACAGGGCAATCAGCCCCTGG + Intergenic
1100089826 12:90955245-90955267 CACCCAGGGCAACAGCCAATTGG + Intergenic
1100356683 12:93837553-93837575 CACACATGGAAACCGCCCGGTGG - Intronic
1106542429 13:30701998-30702020 CAAACAATGGAACCGCCCACAGG + Intergenic
1108435615 13:50398710-50398732 CACACAGAGCAAAAGCCAACAGG - Intronic
1113404277 13:110023543-110023565 CACACAGGGCAGCCCGCCTCAGG - Intergenic
1115941824 14:38618455-38618477 TACACTTGGCAACTGCCCACTGG + Intergenic
1122159809 14:99774673-99774695 CAGGCAGGGCATCCGCCCAAGGG - Intronic
1123862678 15:24485008-24485030 CACACAGTGTAACCACCCAATGG - Intergenic
1125066049 15:35487173-35487195 CACACAGTGCAAGCTCCCAGGGG + Intronic
1125412598 15:39420707-39420729 CACACAGTGCACACACCCACTGG - Intergenic
1129226414 15:74172965-74172987 CACCCAGGCCCACTGCCCACTGG - Intergenic
1131062268 15:89411371-89411393 CACACAGAGCAAGCGCGCGCGGG - Intergenic
1134835291 16:17356032-17356054 CACACAGGCCAGCTCCCCACTGG - Intronic
1143423646 17:6815642-6815664 CATACATGGCAGCCGCCCTCTGG - Intronic
1145264735 17:21374340-21374362 CACACAGGGCCCCTGCCCAGGGG - Intergenic
1146803857 17:35849547-35849569 CGCACAGGGCAGCATCCCACAGG - Intronic
1147620607 17:41864401-41864423 CAGACAGCGCAAACGCCCTCAGG - Intronic
1150726005 17:67652141-67652163 CACAAAGGGCAATAGCCAACAGG - Intronic
1151317065 17:73329479-73329501 CACACGGGGCAGCCTCCCAGTGG - Intergenic
1156364451 18:36412952-36412974 TTCACAGGGCCACTGCCCACTGG + Intronic
1160973609 19:1781272-1781294 CACACAAGTCCACCACCCACAGG + Intergenic
1163649765 19:18510403-18510425 CAGGCCGGGCAACCGCACACTGG + Intronic
1164098527 19:22033652-22033674 CACACATGGCAAAAGCCAACTGG - Intergenic
1164742174 19:30583954-30583976 CACTCAGGGAAACTGCCCATTGG + Intronic
1165015968 19:32880115-32880137 CTCACAGGGCCACAGTCCACTGG + Intronic
1165232082 19:34393561-34393583 CACTCAGGGCCACCTCTCACTGG + Intronic
1165445109 19:35852502-35852524 CTCACAGTGCAACCTCCCCCAGG + Intronic
1166353119 19:42210110-42210132 CACACACGACAACCGCCACCAGG + Intronic
1167529641 19:50007314-50007336 CACACAGGGCACATGCCAACTGG + Intronic
928136517 2:28692084-28692106 CACACACGGCAACAGCCAAAAGG + Intergenic
928916707 2:36479667-36479689 CACACAGGGCAACACTCCCCAGG - Exonic
929538978 2:42805117-42805139 CTCACCGGGAAGCCGCCCACTGG + Intergenic
930221421 2:48750229-48750251 CACACAAGGTAACAGCCCCCAGG - Intronic
932079139 2:68695405-68695427 CACACAGTGTAACTGCCCAGTGG - Intronic
936452495 2:112644278-112644300 CACACAAAACAACCGCACACTGG + Intergenic
937311786 2:120907254-120907276 CACCCAGGGCACCCGTCAACAGG - Intronic
944293653 2:198036900-198036922 CAGACAGGGCAACATCCCAGAGG + Intronic
945304944 2:208250717-208250739 CACACAGGGCAAAGGGACACAGG + Intronic
948990516 2:241551687-241551709 GGCACAGGGAAACCCCCCACGGG + Intergenic
1169355229 20:4899649-4899671 CACACATGGCATCGGCCAACAGG + Exonic
1170665543 20:18382967-18382989 GACACAGGGCAAACCACCACAGG + Intergenic
1171185305 20:23120473-23120495 CACACAGGGCAAGGGGCAACTGG - Intergenic
1171481941 20:25460888-25460910 CACACTGGGCACTCGCCCTCTGG + Intronic
1172046551 20:32084549-32084571 GACCCAGGGCCACAGCCCACAGG + Intronic
1172619973 20:36312396-36312418 CACACAGTGCAGCCGCCCCCCGG + Intronic
1175457751 20:59128003-59128025 CACACTGGGCCACGGCCCCCAGG - Intergenic
1177075531 21:16567318-16567340 CACACGGGTCAACTGCCCAAGGG - Intergenic
1178945844 21:36947031-36947053 CGAACAGGGCAACCTCCCGCGGG + Intronic
1183097335 22:35560946-35560968 CACAGAGGGCAAATGCCTACTGG + Intergenic
1184662997 22:45974144-45974166 CCCACAGGGCAAAGGCCCTCAGG + Intronic
1184827927 22:46965738-46965760 CACACCAGGCCACCGGCCACAGG - Intronic
1184838856 22:47040677-47040699 CGCACGGGGTAACCTCCCACAGG - Intronic
950499446 3:13354455-13354477 TACACAGGACAGCCCCCCACAGG + Intronic
951614092 3:24522363-24522385 CACACAGTCCAGCCTCCCACCGG - Intergenic
961354944 3:126331748-126331770 CACACAGTGCATGCACCCACTGG - Intergenic
968067444 3:195766517-195766539 CACACAGTTCAACCTCCTACAGG - Intronic
969945783 4:10782039-10782061 CAAACAAGGAAACAGCCCACAGG - Intergenic
970627726 4:17907695-17907717 AACACAGGGAACCCCCCCACCGG + Intronic
977996855 4:103505001-103505023 CACTCAGGGCAACCACAAACTGG + Intergenic
982460152 4:155659653-155659675 CACACAGGACACCCACTCACTGG - Intergenic
985564505 5:608655-608677 CTCACAGGGCACCAGCCCTCAGG - Intergenic
985723888 5:1505614-1505636 CTCACAGTGCATCCCCCCACTGG - Intronic
990158519 5:52907786-52907808 CCCACATGGCAACCGTCAACTGG - Intronic
990449376 5:55920332-55920354 CACCCAGGGCAGTGGCCCACGGG + Intronic
993504436 5:88693159-88693181 CACACACAGCAACCGCCTATGGG + Intergenic
997688322 5:135805773-135805795 CACACAGGGTATACACCCACTGG - Intergenic
997688331 5:135805849-135805871 CACACAGGGTATACACCCACAGG - Intergenic
1000040964 5:157484919-157484941 CTCCCAGGGCAACCAGCCACAGG + Intronic
1000367703 5:160506416-160506438 CACAAAGGGCAAGAGCCCAAAGG - Intergenic
1002501350 5:179649552-179649574 CGCCCAGGGCAGCCGCCCCCAGG - Intergenic
1012252322 6:96992344-96992366 GAGACAGGACAACTGCCCACCGG - Intronic
1017822563 6:158060065-158060087 CCCACAGGGCACCCGGCCTCAGG + Intronic
1019347997 7:539882-539904 CACACAGGGCAGCCGCCTGGAGG - Intergenic
1019406036 7:884552-884574 CACACAGGCCCTCCCCCCACAGG - Intronic
1019616422 7:1964956-1964978 CACCCAGGCCAGCCTCCCACGGG + Intronic
1019690111 7:2405688-2405710 CACAAAGCGCCACCGCCCAGTGG - Intronic
1023590000 7:41771695-41771717 CTCACAGGGAAACCGCCAAAGGG + Intergenic
1024560936 7:50644744-50644766 CCCACTGGGCCACCACCCACTGG + Intronic
1025021722 7:55485673-55485695 CACACAGGGCGCCCGCACACGGG + Intronic
1029448596 7:100628136-100628158 CACACTGGTCACCCACCCACAGG - Exonic
1032323932 7:130909217-130909239 CACATGGTGCAACTGCCCACTGG + Intergenic
1034434191 7:151055346-151055368 CACACTGTGGTACCGCCCACCGG - Exonic
1035726728 8:1829373-1829395 CACACAGGGCAACCGCCCACAGG - Intronic
1038326420 8:26576476-26576498 CTGCCAGGGCAACCTCCCACGGG + Intronic
1044604367 8:94036080-94036102 CACCCACGGAAACCTCCCACTGG + Intergenic
1049782847 8:144436666-144436688 CACACAGGGCCTCAGCCCGCTGG - Exonic
1060266147 9:122112504-122112526 CACTCAGGACCACCGCCCAGAGG + Intergenic
1062214279 9:135380686-135380708 CACAGAGGGCAAACGCTCAGTGG - Intergenic
1194856209 X:98932700-98932722 TACACAGGGCAACAGAGCACAGG - Intergenic
1195113902 X:101676690-101676712 CAGACAGGGCAAAGGCCCTCAGG + Intergenic
1199996146 X:153028061-153028083 CAGACACTGCAACCACCCACGGG - Intergenic
1200935684 Y:8736264-8736286 CACACAGGGCAGCCACCAAAAGG + Intergenic