ID: 1035726733

View in Genome Browser
Species Human (GRCh38)
Location 8:1829387-1829409
Sequence AAGCTGGCCCGGCCCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035726733_1035726741 15 Left 1035726733 8:1829387-1829409 CCCTGTGTGGGCCGGGCCAGCTT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1035726741 8:1829425-1829447 CTGGAGCCAGCCCCTGACCCTGG No data
1035726733_1035726739 -4 Left 1035726733 8:1829387-1829409 CCCTGTGTGGGCCGGGCCAGCTT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data
1035726733_1035726736 -9 Left 1035726733 8:1829387-1829409 CCCTGTGTGGGCCGGGCCAGCTT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1035726736 8:1829401-1829423 GGCCAGCTTGAAGTCCGCTGAGG No data
1035726733_1035726737 -8 Left 1035726733 8:1829387-1829409 CCCTGTGTGGGCCGGGCCAGCTT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1035726737 8:1829402-1829424 GCCAGCTTGAAGTCCGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035726733 Original CRISPR AAGCTGGCCCGGCCCACACA GGG (reversed) Intronic
900414290 1:2527995-2528017 AGGCAGGGCAGGCCCACACACGG + Intergenic
902502815 1:16922102-16922124 ACGCTGCCCCGCCCCAGACAGGG - Intronic
902841123 1:19074567-19074589 AAGCTGGCCGGGACAACTCATGG + Exonic
903519291 1:23935180-23935202 AGACTGGCACGGCCAACACAGGG - Intergenic
904379417 1:30101142-30101164 CAGCTGTCCCTGCCCACAGATGG + Intergenic
904960278 1:34327307-34327329 CACCGCGCCCGGCCCACACAAGG - Intergenic
905541622 1:38764669-38764691 AGGCTGGCCTGGCCCTCTCATGG + Intergenic
905672219 1:39799288-39799310 AAGCGGCCCAGGCCCACACGAGG - Intergenic
905674737 1:39817519-39817541 AAGCTGCCCAGGCCCACACGAGG + Intergenic
907300707 1:53484852-53484874 GAGCTGGCCCGGCCCAGGCCCGG - Intergenic
907697749 1:56751049-56751071 AAGCTGGCCAGGCACTCCCAAGG - Exonic
913323895 1:117609768-117609790 GAGCTGGCCTGGCACACAGAAGG + Intronic
914808923 1:151012333-151012355 AAGTTGGGCAGCCCCACACACGG + Intronic
915569063 1:156734105-156734127 AAGCGGGCCCTGCCCTGACACGG - Exonic
923513408 1:234673289-234673311 AAGGTGGCCAGGGTCACACAGGG + Intergenic
923717076 1:236434165-236434187 AAGCTGTCCTGGGCCACATAAGG - Intronic
924704801 1:246491779-246491801 AAGCTGGCCAGGCCCTCACAGGG + Intronic
1066585565 10:36930644-36930666 AAGCTGTCCTGGGCCACATATGG + Intergenic
1071403108 10:85297949-85297971 AGGCTGGCCCTGCACATACATGG - Intergenic
1074285186 10:112091293-112091315 AAGCTGTCCTGGGCCACACATGG - Intergenic
1074822618 10:117192246-117192268 AAGCTGGCACAGCCCATGCAGGG + Intergenic
1076045538 10:127291519-127291541 AAGCTGGCGCTCCCAACACATGG - Intronic
1076507664 10:130988359-130988381 AGGCTGCCCCGGCCCACAACTGG - Intergenic
1076768497 10:132650699-132650721 AAGGTGGCCCAGCACGCACAGGG + Intronic
1077270693 11:1678221-1678243 ACCCTGACCCGGCCCACCCATGG - Intergenic
1078439184 11:11350241-11350263 AAACTGGCCCATCCCATACAGGG + Intronic
1083732679 11:64661220-64661242 AAGGTGGAGGGGCCCACACAAGG - Intronic
1084309717 11:68309842-68309864 CTGCTGGCCAGGCCCCCACAGGG + Intergenic
1084694524 11:70745676-70745698 GAGCTGGCCTGGCCCCCACCTGG + Intronic
1085267997 11:75248814-75248836 AAGCTGACTCGGCTCCCACACGG - Intergenic
1089317226 11:117600458-117600480 TAGCAGGCCCAGCCCACAGAGGG + Intronic
1089560861 11:119342482-119342504 CAGCTGGCCCCGCCCCCTCAGGG + Intronic
1091442789 12:524515-524537 AAGTTTTCCAGGCCCACACAGGG - Intronic
1091957095 12:4654891-4654913 AAGCTGGCCCAGGTCACCCATGG - Exonic
1094222785 12:28012513-28012535 AAGCTGGCCCTGGCTACATAAGG + Intergenic
1096241158 12:49961235-49961257 AAGCTCGCCCGGCCCAGGCCGGG + Intergenic
1101015605 12:100497096-100497118 AAGCTGGCCTCCCCCACACCAGG - Intronic
1102072684 12:110034896-110034918 AAGCAGCCCCTGCCCTCACAGGG + Intronic
1104664770 12:130639999-130640021 AAGCTAGCCAGGTCCCCACAGGG - Intronic
1105780953 13:23704925-23704947 GAGCTGGCCAGGCCCACCCAGGG - Intergenic
1108222344 13:48248775-48248797 AATCTGTCCTGGGCCACACACGG + Intronic
1110621708 13:77603539-77603561 AGGCTGGGCTGGCACACACAGGG + Intronic
1113426631 13:110213727-110213749 AAGCGGGCCTGTCCCACGCATGG + Intronic
1113644241 13:111981154-111981176 GAGCTGGCTCTGCCCACACCTGG - Intergenic
1119480367 14:74954721-74954743 AGGCTGGCCCTGCCCCCACCAGG - Intronic
1121339696 14:93098028-93098050 CACCTGGCCCAGCCCACACTTGG - Intronic
1122171364 14:99877975-99877997 AAGCTGTCCTGAGCCACACAAGG - Intronic
1124592081 15:31062391-31062413 AAGCTGAACGAGCCCACACAGGG - Intronic
1126140127 15:45430542-45430564 GCGCTGGCCCGGCCCACCCGGGG + Intronic
1132083922 15:98891252-98891274 ATGCTGGCCAGGCCCAGAGAAGG + Intronic
1132345250 15:101104262-101104284 CAGCTGCCCCGTCCCACAGATGG + Intergenic
1133205945 16:4233663-4233685 CAGCTGGCCAGGACCTCACAGGG + Intronic
1133220601 16:4317641-4317663 TAGCTGGCCTGGCCTGCACAGGG + Intronic
1134896893 16:17896275-17896297 AAGCTGGCCCAGCCCAGACTGGG + Intergenic
1135193561 16:20375731-20375753 AAACTGGCCTGGCCCAAGCATGG + Intronic
1137494496 16:48959227-48959249 AAGCTGGCCAGCCCCACACCAGG - Intergenic
1139356732 16:66371290-66371312 GAGCTGCCCAGGGCCACACACGG + Intronic
1140378944 16:74469084-74469106 AGGCTGGCTGGGGCCACACAAGG + Intronic
1140819179 16:78647295-78647317 ATGCTGGCCCGGCCCAGGCGAGG + Intronic
1142414707 16:89935097-89935119 AAGCTGGCCACGCCCACCTACGG + Exonic
1143057638 17:4174110-4174132 AAGCAGGCTCGGCCCCCATAAGG - Intronic
1143707558 17:8709519-8709541 CATCGTGCCCGGCCCACACATGG - Intergenic
1144347504 17:14362690-14362712 AAGCTGTCCTGGGCCACATACGG - Intergenic
1147906961 17:43829817-43829839 AGGCTGGCCCGCCGCTCACAGGG + Intronic
1148053711 17:44781348-44781370 CAGCTGGCACTGCCCACTCAAGG + Exonic
1148463009 17:47848803-47848825 CAGCTGCCCAGGCCAACACAAGG + Intronic
1152016489 17:77754251-77754273 AAGCTGGCCTGGGCCTCACTCGG + Intergenic
1154205849 18:12336056-12336078 AAGCTAGCTTGGCCCACACCCGG - Intronic
1156439125 18:37166355-37166377 AAGCTGTCCTGGGCCACATATGG - Intronic
1160244461 18:77145843-77145865 CAGGAGGCCCGGCCCTCACACGG - Intergenic
1160938692 19:1609977-1609999 CAGCTAGCCAGGCCCACACCTGG + Exonic
1161236728 19:3201923-3201945 AATCCGGCCCCGACCACACAGGG - Intronic
1161245930 19:3251961-3251983 CACCAGGCCCGGCCAACACAGGG + Intronic
1161323202 19:3650641-3650663 AGGCAGGCCCTGCCCTCACAGGG - Intronic
1162934704 19:13976076-13976098 AAGCTGGCAGGGGCCAGACAGGG - Intronic
1163439010 19:17312232-17312254 ACCCTGGCCGGGCTCACACAGGG - Intronic
1163560963 19:18019218-18019240 GATCTGGCCCTGCCCACAGAGGG - Intergenic
1163727156 19:18929311-18929333 AGCCCGGCCCGGCCCACCCAGGG + Exonic
1166001746 19:39881593-39881615 AGGCTGGCCTCTCCCACACAGGG - Intronic
1166004528 19:39897844-39897866 AGGCTGGCCTCTCCCACACAGGG - Intronic
1166669884 19:44703538-44703560 CTCCTGGCCCGGCCCACACGGGG + Exonic
1167369136 19:49070544-49070566 AAGCTGTCCCGGCACTCAAAGGG - Exonic
925057309 2:865059-865081 CAGGTGGCCCTGCCCACACCTGG + Intergenic
930071609 2:47370093-47370115 CAGGCGGCCCGGACCACACAGGG + Intronic
930509519 2:52326878-52326900 CAGTTTGCCTGGCCCACACAAGG - Intergenic
932676155 2:73783324-73783346 AACCTGGCCCAGCCCAAAGAAGG + Intergenic
932676738 2:73788215-73788237 AACCTGGCCCAGCCCAAAGAAGG + Intronic
932677323 2:73793112-73793134 AACCTGGCCCAGCCCAAAGAAGG + Intronic
932677908 2:73798010-73798032 AACCTGGCCCAGCCCAAAGAAGG + Intronic
932678495 2:73802910-73802932 AACCTGGCCCAGCCCAAAGAAGG + Intronic
932679079 2:73807810-73807832 AACCTGGCCCAGCCCAAAGAAGG + Intronic
934677275 2:96258463-96258485 AGGCTGGCTGGGCCCAGACAAGG + Intronic
934860760 2:97762065-97762087 TAGCTGCCCCGGGCCACAAAGGG + Exonic
935838066 2:107076873-107076895 CAGATGGCCTGACCCACACATGG + Intergenic
937906376 2:127054796-127054818 ACGGTGGCCCTGGCCACACAGGG + Intronic
941453546 2:165689476-165689498 ACGCTGTCCCAGCACACACAAGG + Intergenic
948574057 2:238938496-238938518 CAGCTGGCCCCGACCACGCAAGG - Intergenic
948593400 2:239065092-239065114 AAGCTGGCCCTGCTCACTCCAGG - Intronic
948610512 2:239163534-239163556 CAGCTGCCCCTGCCCTCACAGGG - Intronic
948803192 2:240442013-240442035 AGGCTGGCCTGGCCCTCTCAGGG - Intronic
1168880956 20:1205606-1205628 AAGCTGGTCGGGGCAACACATGG - Intronic
1171727794 20:28641487-28641509 AAGCTGTCCTGGGCCACACATGG - Intergenic
1174549322 20:51350321-51350343 AAGCTGCCACAGCCAACACAAGG + Intergenic
1175780367 20:61678657-61678679 GAGCTAGCCCTGCCCACACCTGG - Intronic
1175798435 20:61786823-61786845 GAGCTGGCCTGGCAGACACAAGG - Intronic
1176820375 21:13650523-13650545 AATCTGGCCAGGGCCACAGAAGG - Intergenic
1177910750 21:27028338-27028360 AAGCTGGCCTTGCCTATACACGG + Intergenic
1179998535 21:44984912-44984934 AAACTGCCCCCACCCACACAGGG + Intergenic
1180123631 21:45770796-45770818 AGGCTGGCCCCAGCCACACAGGG - Intronic
1180184456 21:46132609-46132631 AAGCGGGCCCGGGTCCCACACGG + Exonic
1180392144 22:12293997-12294019 AAGCTGTCCTGGGCCACACGTGG - Intergenic
1180407603 22:12570774-12570796 AAGCTGTCCTGGGCCACACGTGG + Intergenic
1180922879 22:19530961-19530983 AGGCTCTCCCTGCCCACACATGG + Intergenic
1180955834 22:19740817-19740839 TCGCTGGCCCTGCCCCCACAAGG - Intergenic
1181811849 22:25408045-25408067 CTGCTGGCCAGGCCCCCACAGGG - Intergenic
1182440748 22:30362489-30362511 AAGCTGGGGCAGGCCACACAGGG + Intronic
1182750142 22:32634851-32634873 AAGCTGTCCTGGGCCACACATGG - Intronic
1183810826 22:40255722-40255744 AATCTGGCCCGAACTACACAAGG + Intronic
952931304 3:38362998-38363020 AACCTGGCCCGCCCCGGACAAGG - Exonic
954081833 3:48216811-48216833 AAGCTGGCCCTTCCCACCCAGGG + Intergenic
954334241 3:49906909-49906931 AAGCTGGAGTGGTCCACACAAGG - Intronic
954689590 3:52388638-52388660 AAGCGGGCCCGGCCCAGACAGGG + Intronic
958118378 3:89252529-89252551 AAACTGGCCTGGGCAACACAGGG + Intronic
959737678 3:109678738-109678760 AAGCTGGCTGGAACCACACAAGG - Intergenic
960008303 3:112804893-112804915 AAGCTGGCTCGGCCAACTGAAGG - Intronic
960950454 3:122995518-122995540 CGGCTGGCCTGGGCCACACATGG + Intronic
961170848 3:124796766-124796788 AAGCTGTCCCAGCAGACACACGG - Exonic
962756331 3:138467957-138467979 AAGGTGGACCAGCCCAGACAGGG - Intronic
968655572 4:1777147-1777169 TAGGTGGCCCGGCCCTCAGAGGG + Intergenic
969214299 4:5710247-5710269 CCCCTAGCCCGGCCCACACAGGG + Intergenic
969624029 4:8293465-8293487 GAGCTGGCCAGGCCCTGACAGGG + Intronic
970158317 4:13163848-13163870 AAGCTGGCCCTCACCAGACACGG + Intergenic
971238327 4:24864108-24864130 AAGTTAGCCCGGCCCACGCCGGG - Intronic
977559272 4:98516151-98516173 AAACTGGCCCTGCCCCAACAGGG + Intronic
985432766 4:189897377-189897399 AAGCTGTCCTGGGCCACACGTGG + Intergenic
1202762734 4_GL000008v2_random:126074-126096 AATCTGGCCAGGGCCACAGAAGG + Intergenic
985600130 5:824085-824107 GAGGTGGCCCTGCCCCCACAGGG + Intronic
985889754 5:2706152-2706174 CAGGTGCCCCGGCCCACAGAGGG + Intergenic
993950899 5:94173815-94173837 AGGCTTGCCCTGCCCACATAAGG - Intronic
994355143 5:98786280-98786302 AATCTTGCCTGGCTCACACAGGG - Intronic
997714004 5:136028897-136028919 AAGCTGGGCCGGCCCGTGCAAGG - Exonic
1000222994 5:159232334-159232356 AAGCTGCCCCTGCTCACCCAAGG - Intergenic
1002198703 5:177514812-177514834 GAGCTGGCCCGGCAGACCCATGG - Exonic
1002310483 5:178310740-178310762 AAGCTGGCCCTGCTCTCCCAGGG - Intronic
1002549102 5:179973778-179973800 AAACAGGCCCGCCACACACAGGG + Intronic
1002721859 5:181266033-181266055 AGGCTGGACTGGCCCACACCGGG - Intergenic
1003136145 6:3435953-3435975 AAACTGACCCTGCCCACACCTGG + Intronic
1004198571 6:13527304-13527326 ATCCTGACCCTGCCCACACAAGG + Intergenic
1018838078 6:167500075-167500097 AAGATGGCCCTGCCCACAAGGGG + Intergenic
1020013075 7:4816844-4816866 AAGCTGGCCAGGGCCACAGGGGG + Intronic
1022305903 7:29146392-29146414 GAGCTGGCACGACCCACGCAGGG + Intronic
1023078518 7:36506308-36506330 AAGCTGGGCTGGCCCAGAGAAGG - Intergenic
1024395001 7:48856024-48856046 AAGCTGTCCTGGCCCACATGCGG - Intergenic
1024400267 7:48916651-48916673 AAGCTGTCCTGGCCCACATGTGG + Intergenic
1024596811 7:50945476-50945498 AAGCTGGCACGGGCCAGGCATGG + Intergenic
1029175155 7:98659336-98659358 AAGCTGCCCCTGCCCAGGCATGG - Intergenic
1032079653 7:128852530-128852552 AGGCAGGCCCTGCCCTCACAGGG - Intronic
1033182626 7:139195767-139195789 CACCGGGCCCGGCCCACACCTGG + Intergenic
1035726733 8:1829387-1829409 AAGCTGGCCCGGCCCACACAGGG - Intronic
1035735148 8:1882207-1882229 CAGCTGGCCATGCCCCCACATGG + Intronic
1039749824 8:40467578-40467600 AAGCTGTCCTGGGCCACATATGG - Intergenic
1041072091 8:54135341-54135363 AAGTTGGCCAGGCTCACACGCGG - Exonic
1041481030 8:58320001-58320023 AAGCAGGCCCAGGCCACTCAAGG + Intergenic
1041763819 8:61395626-61395648 AAGATTGCTGGGCCCACACATGG + Intronic
1045517016 8:102868597-102868619 AAGCTATGCAGGCCCACACAGGG - Intronic
1047005623 8:120617031-120617053 AAGCTGTCCCGGGCCACATGTGG - Intronic
1047200011 8:122757234-122757256 AAGCTGGCCCTGGCCACACTGGG + Intergenic
1049470397 8:142772766-142772788 ATGCTGGGCAGGCCCACTCATGG - Intronic
1049579819 8:143406246-143406268 AGGCTGGCCGGGGCCACGCAGGG - Intergenic
1049712070 8:144069433-144069455 AAGCAGTCCCGGCACACACCAGG - Intergenic
1053512924 9:38704738-38704760 AAGCGTGCCCGGCCCACATCGGG - Intergenic
1053721945 9:40955596-40955618 AAGCTGTCCTGGGCCACACATGG + Intergenic
1056679205 9:88702351-88702373 AAGCTGTACCAGGCCACACAGGG - Intergenic
1057121359 9:92577749-92577771 AGTCTGGCCCGGGCAACACAGGG + Intronic
1060803040 9:126556794-126556816 AAGTGGTCCCGGCCCACACCAGG - Intergenic
1061720442 9:132547800-132547822 AGGGTGGGCCGGCCCACGCAGGG - Intronic
1062239866 9:135531161-135531183 AAGCGTGCCCAGCCCACACCAGG - Intergenic
1062294732 9:135818383-135818405 AAGCAGCCCCGGCCCTCACGCGG - Intronic
1062467678 9:136688201-136688223 CACCTGGCCCGGCCCCCACCCGG + Intergenic
1203421193 Un_KI270448v1:7856-7878 AAGCTGTCCTGGGCCACACATGG + Intergenic
1203421766 Un_KI270521v1:7372-7394 AAGCTGTCCTGGGCCACACATGG + Intergenic
1203543497 Un_KI270743v1:110955-110977 AATCTGGCCAGGGCCACAGAAGG + Intergenic
1185790326 X:2924320-2924342 CACCGTGCCCGGCCCACACAGGG + Intronic
1186407576 X:9317378-9317400 AAGCTGGCCCCACCCACCCAAGG + Intergenic
1187447812 X:19373656-19373678 GTCCTGGCCCTGCCCACACAGGG - Exonic
1199213795 X:145244538-145244560 AAGCTGTCCTGGGCCACACGTGG - Intergenic
1200041245 X:153371479-153371501 AAGCTGGCCTGGCCCTTGCAGGG - Intergenic