ID: 1035726739

View in Genome Browser
Species Human (GRCh38)
Location 8:1829406-1829428
Sequence GCTTGAAGTCCGCTGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035726728_1035726739 10 Left 1035726728 8:1829373-1829395 CCTGTGGGCGGTTGCCCTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data
1035726733_1035726739 -4 Left 1035726733 8:1829387-1829409 CCCTGTGTGGGCCGGGCCAGCTT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data
1035726734_1035726739 -5 Left 1035726734 8:1829388-1829410 CCTGTGTGGGCCGGGCCAGCTTG 0: 1
1: 0
2: 4
3: 11
4: 176
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data
1035726727_1035726739 15 Left 1035726727 8:1829368-1829390 CCAGGCCTGTGGGCGGTTGCCCT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035726739 Original CRISPR GCTTGAAGTCCGCTGAGGGC TGG Intronic
No off target data available for this crispr