ID: 1035726759

View in Genome Browser
Species Human (GRCh38)
Location 8:1829546-1829568
Sequence AGGCAGCTGGACGTGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035726759_1035726765 -8 Left 1035726759 8:1829546-1829568 CCCTGACCCACGTCCAGCTGCCT 0: 1
1: 0
2: 4
3: 15
4: 202
Right 1035726765 8:1829561-1829583 AGCTGCCTCCACGGAAGCCGCGG No data
1035726759_1035726770 19 Left 1035726759 8:1829546-1829568 CCCTGACCCACGTCCAGCTGCCT 0: 1
1: 0
2: 4
3: 15
4: 202
Right 1035726770 8:1829588-1829610 GTGGCTTTCTGTCGTTTGTGTGG No data
1035726759_1035726771 20 Left 1035726759 8:1829546-1829568 CCCTGACCCACGTCCAGCTGCCT 0: 1
1: 0
2: 4
3: 15
4: 202
Right 1035726771 8:1829589-1829611 TGGCTTTCTGTCGTTTGTGTGGG No data
1035726759_1035726768 0 Left 1035726759 8:1829546-1829568 CCCTGACCCACGTCCAGCTGCCT 0: 1
1: 0
2: 4
3: 15
4: 202
Right 1035726768 8:1829569-1829591 CCACGGAAGCCGCGGCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035726759 Original CRISPR AGGCAGCTGGACGTGGGTCA GGG (reversed) Intronic
900746750 1:4365943-4365965 AGGCCTCTGGAGGTGGGTCTTGG + Intergenic
900921193 1:5671661-5671683 ACGTAGCTGGACCTGGGTCTGGG - Intergenic
900958552 1:5904645-5904667 AGGCACGAGGATGTGGGTCAGGG + Exonic
901221363 1:7585793-7585815 AGGAAGCTGGAGGTGGATGAGGG - Intronic
901627004 1:10630201-10630223 AGGCAGCTGGGCCTGGGGCTGGG - Exonic
902489544 1:16771229-16771251 AGGAACCTGGACTTGGGTGATGG - Intronic
902924690 1:19688409-19688431 GGGCAGATGGAGGTGGGTGATGG - Intronic
903117179 1:21187994-21188016 AAGCCGCTGGACCTGGGGCAAGG + Intergenic
903542788 1:24106252-24106274 AGCCAGCTGGCCTGGGGTCAAGG + Intronic
904270683 1:29348051-29348073 AGAGAACTGGAGGTGGGTCAGGG - Intergenic
905121821 1:35688395-35688417 TGGCAGCAGGACAGGGGTCAGGG + Intergenic
906057368 1:42927673-42927695 TGGCAGCTGGACGTGGACCCTGG + Exonic
906690150 1:47787180-47787202 AGGCAGCTGGATCTGCATCAGGG + Intronic
907796108 1:57719369-57719391 AGCCAGAGGGAGGTGGGTCAAGG + Intronic
915608269 1:156969207-156969229 AGGCAGCAGAACTTGGGTCAAGG + Intronic
917651113 1:177078234-177078256 AGGCAGGTGGACCTGGATCCAGG - Intronic
918133682 1:181650843-181650865 AGCAAGCTGAGCGTGGGTCAAGG + Intronic
918248159 1:182678982-182679004 GGGCAGCTGGAAGGAGGTCAGGG - Intronic
919616330 1:199813297-199813319 AGCCAATTGAACGTGGGTCAAGG + Intergenic
920041458 1:203100372-203100394 AGGCATTGGGAGGTGGGTCAGGG + Intronic
921075288 1:211695728-211695750 AGACAGCTGGAGGAGGGTCACGG - Intergenic
921160729 1:212470477-212470499 AGGCAGCTGCTGGTGGGTGAAGG + Intergenic
923530893 1:234811296-234811318 AGGAACCTGGACTTGGGTCATGG + Intergenic
1063096481 10:2913246-2913268 AGGCACCTGCACGCGGGACAGGG + Intergenic
1063096493 10:2913286-2913308 AGGCACCTGCACGCGGGACAGGG + Intergenic
1063495323 10:6502236-6502258 AGGCAGGTGGAGGTAGGTGAAGG + Intronic
1063929121 10:11011395-11011417 GGGCAGATGGAGGTGGGTGAGGG + Intronic
1065712519 10:28532327-28532349 AGGCAGAAGGCCGTGCGTCAGGG - Intergenic
1066659013 10:37721329-37721351 CGGGAGCTGGACTTGGGTCGGGG - Intergenic
1067110658 10:43397264-43397286 CGGCAGCCGGACGTGGGTCACGG + Intronic
1071552004 10:86573438-86573460 AGGCTGCTAGACCTGGGTCCTGG - Intergenic
1073224174 10:101902692-101902714 AGGCAGCGGGAGGTGGGAAAAGG + Intronic
1073878968 10:107958039-107958061 AGAGAACTGGACGTGGCTCATGG + Intergenic
1074384778 10:113007962-113007984 AGGCAGCTTGACTTGGGGCTTGG + Intronic
1076000143 10:126906830-126906852 AGCCAGCTGGACAGTGGTCACGG + Intronic
1076374822 10:129976315-129976337 AGGCAGCAGGAAGCTGGTCACGG - Intergenic
1078898640 11:15621153-15621175 CAGGAGCTGGACGTGGGTCCAGG - Intergenic
1080698840 11:34626679-34626701 AGGCAGAAGGCTGTGGGTCAAGG + Intronic
1081672238 11:44948951-44948973 TGACAGCTGGACATGGGTGAAGG + Intronic
1090411357 11:126511990-126512012 AGGAAGCTGGAGCTGGGACAGGG + Intronic
1090821814 11:130349443-130349465 GGCCAGCTGGATGTGGGTGACGG - Intergenic
1091322681 11:134663178-134663200 AGGCAGCTGGATCTAGGTCCAGG + Intergenic
1096101708 12:48973789-48973811 AGAGACCTTGACGTGGGTCAGGG + Intergenic
1096616305 12:52835144-52835166 AGGGAGCTGGAGGTGGGTCAAGG + Intergenic
1096652185 12:53067275-53067297 AGGCAGGGGGAGGTGGGTCGAGG + Intronic
1100198725 12:92276079-92276101 AGCTAGGTGGTCGTGGGTCAGGG - Intergenic
1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG + Intronic
1104975124 12:132548775-132548797 GGGCACCTGGACGGGGGTGAGGG + Intronic
1105280870 13:18961910-18961932 GGGCAGCCAGACCTGGGTCAGGG - Intergenic
1105605967 13:21926763-21926785 AGGGAGCTGGAGGTGGGAGAAGG + Intergenic
1106351053 13:28930985-28931007 AGTCAGGTGGACCTGGGTCATGG + Intronic
1108486673 13:50934066-50934088 AGCGAGCTAGAAGTGGGTCATGG + Intronic
1112428926 13:99332563-99332585 TCTCAGCTGGACGTGGGCCAGGG + Intronic
1112794378 13:103039461-103039483 AGGCAGCAGGAGGTGGGAGAAGG + Intergenic
1113911409 13:113843170-113843192 AGGGAGGTGGGCGGGGGTCAGGG - Intronic
1116276135 14:42834644-42834666 AGGCAGCTTCACTTTGGTCACGG - Intergenic
1118999588 14:70870258-70870280 AGGAAGCTGGAAGTTGTTCATGG + Intergenic
1119182441 14:72614050-72614072 GGGCAGCTGGTGGTGGGTCTTGG - Intergenic
1119348013 14:73942336-73942358 AGGCAGCTGTGGGAGGGTCAGGG - Intronic
1120156648 14:81100823-81100845 AGGTAGCTGGAAGGTGGTCAAGG - Intronic
1121486827 14:94322858-94322880 AGGATGCTGGCCGCGGGTCAGGG - Intronic
1122138758 14:99649878-99649900 CGGCAGCTGCACGTGGACCAGGG - Intronic
1122347458 14:101069396-101069418 ACCCAGCTGGAGGTGGGGCAGGG + Intergenic
1123706449 15:22954539-22954561 AGGCAGCTGGAACTGTGGCATGG - Intronic
1124008896 15:25818998-25819020 AGACTGCTGGACGTTGGTCTAGG + Intronic
1124209922 15:27754101-27754123 AGTCAGCTGCACGTGTCTCAAGG + Intergenic
1125655050 15:41349376-41349398 GAGCAGCTGGACTTGGGTCTGGG - Intronic
1126797952 15:52275522-52275544 AGGCAGCTGGGTGTTGGTGATGG - Intronic
1127899816 15:63332808-63332830 AGGGAACTGGAGATGGGTCAGGG + Intronic
1130561201 15:84960624-84960646 AGCCACCTGGATGTGGGTGATGG + Intergenic
1131383834 15:91986231-91986253 AAGCAGCTGAGCCTGGGTCAGGG + Intronic
1132484469 16:183297-183319 AGGGAGCTGGCCCTGGCTCAAGG + Intergenic
1132602838 16:781647-781669 AGGCAGCTGGACATGGCTTCTGG - Intronic
1132807192 16:1780265-1780287 TGGTAGCTGGAAGTGGGGCAGGG + Intronic
1132900569 16:2251747-2251769 AGGCACCTGGATCTGGGCCAGGG + Intronic
1133008926 16:2899491-2899513 AGGAAGCGAGACTTGGGTCAGGG - Intergenic
1133113899 16:3565092-3565114 AGGCTGCTGGATGGGGGGCACGG - Exonic
1133231567 16:4369452-4369474 AGACCCCTGGACCTGGGTCAGGG - Intronic
1133235269 16:4384695-4384717 AGGAGGCGGGCCGTGGGTCATGG + Intronic
1136248819 16:28990238-28990260 GGGCAGCTGGAAGTGGCTCTGGG + Exonic
1137440993 16:48498373-48498395 CTGCACCTGGACGTGGCTCAGGG - Intergenic
1141138752 16:81483611-81483633 GGGCAGCTGGGGGAGGGTCAGGG - Intronic
1141161164 16:81630063-81630085 AGCCAGCAGGAAGTGGATCAGGG - Intronic
1141787471 16:86211357-86211379 GGGCAGCAGGAGGTGGGGCAGGG + Intergenic
1142166604 16:88593599-88593621 AGGCCGCTGGACTTGGGTGCCGG - Intronic
1143318182 17:6048746-6048768 AGTCAGCTGGCCCTGGGTCCTGG + Intronic
1143910348 17:10243816-10243838 AGGCAGCTGGCTGTGGTGCAGGG + Intergenic
1146655137 17:34630568-34630590 AGGCAGCAGGGGGTGGGTGAGGG + Intronic
1147137659 17:38443564-38443586 AGGCAGCTGGACAGGTGGCAGGG - Intronic
1148108674 17:45132546-45132568 AGGCAGCAGGAGGTGGGGCGGGG + Intronic
1148203538 17:45765641-45765663 AGGGAGCTGGAAGAGGGTCCTGG + Intergenic
1148779985 17:50115913-50115935 AGGCAGCAGGAAGTGGGGCAGGG + Intronic
1152464263 17:80456931-80456953 AGAGAGCTGGACGGGGGACAAGG - Intergenic
1152531110 17:80919817-80919839 CGGCAGCTGTAAGAGGGTCAAGG - Intronic
1156341255 18:36212378-36212400 TGGGAGCTGGACGGGGGTCGGGG + Intronic
1158401399 18:57124438-57124460 AGGAATCTGGACGTGGGCCCCGG + Intergenic
1160659819 19:292633-292655 AGACACCTGCACGTGGGGCAGGG + Intergenic
1160998714 19:1897768-1897790 AGGCAGCTGCACCCCGGTCACGG - Intergenic
1162385915 19:10360619-10360641 AGTCAGAGGGATGTGGGTCAGGG + Intronic
1162467780 19:10852842-10852864 AGGAGGCTGGACATGGGTTATGG + Intronic
1162789414 19:13055308-13055330 AGGCTGCTGGGCCTGGGTCCAGG - Intronic
1163739853 19:19004729-19004751 AGGAAGGTGGAGGTGGGACAAGG + Intronic
1164113319 19:22191486-22191508 AGGAAGCTGGAACTGAGTCATGG - Intronic
1164285355 19:23810659-23810681 AGGGAGCTGGAAATGAGTCATGG + Intronic
1164297179 19:23922363-23922385 AGGGAGCTGGAACTGAGTCATGG + Intronic
1164317671 19:24108157-24108179 AGGGAGCTGGAACTGAGTCATGG + Intronic
1164694587 19:30233851-30233873 GGGCAGCTGAACGTGGGTCACGG - Intronic
1165767689 19:38361330-38361352 AGGCAGCTGGAGTCGGGACAGGG + Intronic
1166053578 19:40275314-40275336 ATGCAGAGCGACGTGGGTCAGGG - Intronic
1167308442 19:48721945-48721967 GTGCAGCTGGGCGGGGGTCAAGG + Exonic
925227787 2:2200613-2200635 AGGAAGGTGGACATGGGCCATGG + Intronic
925346226 2:3173869-3173891 AGGCAGCTGGACATGGGGCAGGG - Intergenic
925685712 2:6470768-6470790 AGGGAGCAGGATGTGGGACATGG + Intergenic
926059659 2:9797274-9797296 GGGCAGCTGTTCGTGGGACAAGG + Intergenic
926858225 2:17280608-17280630 CAGGGGCTGGACGTGGGTCAGGG - Intergenic
927674078 2:25091624-25091646 AGGCAGCTGGAAGTGCGTCTTGG + Intronic
930017641 2:46981927-46981949 AGGCAGGTGGACCTGGGCCTTGG + Intronic
931890413 2:66665305-66665327 TGCAAGCTGGACATGGGTCAGGG + Intergenic
932469589 2:71945177-71945199 AGGCTCCTGGCCCTGGGTCAGGG - Intergenic
934516996 2:94994510-94994532 ATGCAGCTGGACATAGGGCAGGG - Intergenic
934524459 2:95043044-95043066 GGGCAGCCGGGCTTGGGTCAAGG - Intronic
934758306 2:96839618-96839640 AGCCAGCTGCACCGGGGTCACGG + Exonic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
942951565 2:181728071-181728093 AGGCAGCTGAAGGTGGGGGATGG - Intergenic
943858467 2:192828713-192828735 AGACAGCTGGACGGTGATCAAGG - Intergenic
946585132 2:221177567-221177589 AGGCAGGTGGTCCTGGTTCATGG - Intergenic
946777460 2:223158319-223158341 AGGCAGCTGGAAGTGGGGGTGGG + Intronic
947374275 2:229480002-229480024 TGGCTGCTGGCTGTGGGTCATGG - Intronic
947839199 2:233196890-233196912 CGGAAGCTGGAAGTGGATCAGGG - Intronic
1170509718 20:17064212-17064234 AATCAGCTGGACTTGGCTCATGG + Intergenic
1170662256 20:18353445-18353467 AGTCAGCTGGGCTTGGGTCCAGG + Intergenic
1171444852 20:25195982-25196004 AGGCAGCAGGAGGTGGGACCCGG - Intronic
1171773499 20:29345544-29345566 ACGTAGCTGGACCTGGGTCTGGG + Intergenic
1171869600 20:30514431-30514453 AGACAGCTGGACGGTGGCCATGG - Intergenic
1174157369 20:48524556-48524578 GGGCAGCTGGACCTGGGGAAGGG + Intergenic
1174411476 20:50339470-50339492 AGGCAGCTGGGGGTGGCTGAGGG + Intergenic
1175223176 20:57429169-57429191 AGGCGGCTGGGGGTGGGGCAAGG - Intergenic
1175325852 20:58128076-58128098 TGGCAGCTGGACGGGTGGCAAGG + Intergenic
1178230634 21:30780368-30780390 AGGCAGATGGACATGAGTCTTGG - Intergenic
1178405223 21:32317890-32317912 GGTCAGCTGGACGGGGGCCAAGG + Exonic
1180336233 22:11578913-11578935 ACGTAGCTGGACCTGGGTCTGGG - Intergenic
1182061006 22:27397394-27397416 AGGCGGGTGGTCGTGGGTCCTGG - Intergenic
1182461942 22:30489605-30489627 AGGCAGCTGGGTGAGGGTCCTGG - Exonic
1182766385 22:32760904-32760926 AGGCAGCTGGTCCAGGGTCAAGG + Intronic
1183571364 22:38656075-38656097 AGGCTGCCAGAGGTGGGTCATGG + Intronic
1184158959 22:42686743-42686765 AGGCAGCTGAATGAGGGGCATGG - Intergenic
1184893156 22:47391692-47391714 AGGCAGCTTTGCCTGGGTCATGG - Intergenic
950121401 3:10484501-10484523 TGGCAGCAGCAGGTGGGTCATGG - Intronic
953681976 3:45046253-45046275 AGCCAGCTAGCCGTGGGTCCGGG + Intergenic
953808808 3:46094703-46094725 AGGGAGCTGGAAGTGGTTAAGGG - Intergenic
954155215 3:48681596-48681618 AGGGGGCTGGACTTGGGACACGG + Exonic
954375568 3:50192528-50192550 AACCAGCTGGAGGTGGGTGAGGG + Intronic
954462708 3:50636846-50636868 TGGCAGCTGGACCTGGGCCCAGG + Intronic
955974350 3:64466147-64466169 AGGCAACTGTACGTGGGTTATGG + Intergenic
958992310 3:100860958-100860980 ATGCAGCTGCACCTGGGTGATGG + Intronic
961091190 3:124114093-124114115 AGGCAGCTGGATGAGGGACCAGG + Intronic
962035093 3:131643276-131643298 AGGTATCTGGATGTGAGTCATGG + Intronic
962742475 3:138371978-138372000 AGGCAGCTGGAAGTGGGACCAGG - Intronic
962790093 3:138803566-138803588 ATGCAGCAGCACGTGGGCCAAGG + Intronic
967975764 3:195034036-195034058 GGGCACCTGGACGTGGGGCTTGG + Intergenic
968521272 4:1035833-1035855 TGGCATCGGGACGTGGGTCCTGG + Intergenic
969622752 4:8286918-8286940 TGGCAGCTGGCCCAGGGTCACGG + Intronic
975472459 4:74785698-74785720 AGGAAGCTGAAAGTGGGTAAAGG - Intronic
981113220 4:140959261-140959283 AGGCAGCTAGATGGGGGTCAAGG - Intronic
982170431 4:152656208-152656230 AGGCAGATTGACGTGGGTGTTGG - Intronic
983099093 4:163603341-163603363 AGGCAGCTGAACGTGAATCTAGG - Intronic
983128256 4:163981559-163981581 AGGCTGCTGCAAGTGGCTCAGGG + Intronic
985652474 5:1113319-1113341 AGGCAGCTGGAGGGGAGTGATGG + Intergenic
986141293 5:5033125-5033147 AGGCAGCAGGACCTTGGGCAAGG + Intergenic
988930906 5:36034887-36034909 AGGCAGCGGGAAGTGGGTGGAGG - Intergenic
988934772 5:36071028-36071050 AGGCAGCGGGAAGTGGGTGGAGG - Intronic
990780173 5:59351952-59351974 AGGAAGCTGGAGGTGGGAGAGGG + Intronic
993886788 5:93424227-93424249 AGGCATTTGGACGTGGGTCTGGG - Intergenic
998822226 5:146067291-146067313 AGGCGGCTGGATCAGGGTCAAGG + Intronic
1000741221 5:164972797-164972819 AGGAAGCTAGAAGTTGGTCATGG + Intergenic
1001933376 5:175688349-175688371 AGGCAGCAGGACAGGGGGCAGGG - Intergenic
1002199909 5:177521858-177521880 AGGGAGTTGGACTTGGGGCATGG - Intronic
1002878736 6:1233916-1233938 AGGCAGATGTGCCTGGGTCAGGG - Intergenic
1002990497 6:2233847-2233869 AGGCAGCTGGACTTGGTCCAGGG + Intronic
1006408242 6:33857360-33857382 AGGCAGTTTGACGTAGGGCAAGG - Intergenic
1007248901 6:40482459-40482481 AGGCAGGTGGGGGTGTGTCAGGG - Intronic
1007402185 6:41609120-41609142 AGGAAGCTGGGGGTGGGTCGTGG - Intergenic
1007757314 6:44108393-44108415 AGGCAGGTACACATGGGTCAGGG - Intergenic
1009610282 6:65931567-65931589 GGGCAGCTGCACCTGTGTCAGGG + Intergenic
1012981001 6:105830876-105830898 AGGCAGCTGGAGGAGGGGAAGGG + Intergenic
1013112861 6:107078400-107078422 AGGCAGCTGAATGCTGGTCATGG + Intronic
1017075014 6:150609915-150609937 AGGATGCTGGACGTGGGAAACGG - Intronic
1018136550 6:160783726-160783748 AGGCAGCTAGAGGAGGCTCAGGG + Intergenic
1018902599 6:168058930-168058952 GGGCAGGTGGACGTGGGTGGAGG - Intronic
1023880043 7:44313148-44313170 AGGCAGCGGGAGGTGGGTGGAGG - Intronic
1027870201 7:83696850-83696872 AGGCTACTGGATGTGAGTCAAGG + Intergenic
1028462509 7:91111409-91111431 AGGCAGCCAGAAGTGGGTGAGGG - Intronic
1028897861 7:96062123-96062145 CTGCAGCTGGACGTGGGCCAGGG - Intronic
1029283613 7:99451936-99451958 AGGCACCTGCAGGTGGCTCAGGG + Intronic
1030365815 7:108644919-108644941 TGGCAGCTGGATCTGGGTAAGGG - Intergenic
1030376291 7:108756401-108756423 ACGCAGCTGGTCAGGGGTCAGGG - Intergenic
1031961632 7:127995345-127995367 AGTCAGCTGTATGTGGGTCAGGG - Intronic
1033226823 7:139569147-139569169 AGCCAGCTGGAAGTGGGTGGAGG - Exonic
1033457475 7:141515918-141515940 AGGAAGGTGGACCTGGGCCAAGG + Intergenic
1035726759 8:1829546-1829568 AGGCAGCTGGACGTGGGTCAGGG - Intronic
1036528403 8:9556442-9556464 GGGCAGCAGGACCTGGGACAGGG + Exonic
1036975279 8:13404306-13404328 TGGCAGCTTGAAATGGGTCAGGG - Intronic
1039934760 8:42032195-42032217 AGGCAGCTTGATGTGGCTCAAGG + Intronic
1044837362 8:96309440-96309462 AGGCAGCCTGACATGGGACAAGG + Intronic
1045499807 8:102736613-102736635 AGGAAGCTGGTGGTGGGTTAGGG - Intergenic
1045966721 8:108033335-108033357 TAGCAGCTGGACTGGGGTCATGG - Intronic
1047251008 8:123182276-123182298 AGGGAGCTGGACACGGGCCAGGG - Exonic
1048459941 8:134613413-134613435 GGGGGGCTGGACGTGGGTGAAGG + Intronic
1049509995 8:143022528-143022550 AAGCAGCTGGCTGTGGCTCAGGG - Intronic
1053148667 9:35729267-35729289 AGCCAGCTGGAGATGTGTCAGGG + Intronic
1056065501 9:82929443-82929465 AGGCAGCTGGAAGAGGTTTATGG + Intergenic
1056161825 9:83903828-83903850 AGGCAGCTGAAGATGGATCATGG - Exonic
1057196009 9:93115866-93115888 AGGGAGGTGGAAGTGGGTGAGGG + Intergenic
1059638824 9:116196262-116196284 AGGCAGCTGGGAATGGGACAGGG - Intronic
1059945407 9:119404207-119404229 AGCCAGCAGAAAGTGGGTCAGGG + Intergenic
1060143881 9:121234481-121234503 AGCCAGCTGCTCCTGGGTCATGG + Intronic
1061934594 9:133850310-133850332 CTGCAGCTGTACCTGGGTCAGGG - Intronic
1062080548 9:134621210-134621232 GGGCAGCTGGACGCCCGTCAAGG + Intergenic
1062210998 9:135364009-135364031 AGGAAGCTGGAGGTGAGTGACGG - Intergenic
1062678054 9:137759914-137759936 ATGCCGCTGGTTGTGGGTCAGGG + Intronic
1185593924 X:1295811-1295833 AGCTAGGTGGACGTGGGGCAGGG - Intronic
1197760819 X:130026845-130026867 AGGCAGCTGGATTTGGCACATGG + Intronic