ID: 1035727058

View in Genome Browser
Species Human (GRCh38)
Location 8:1831229-1831251
Sequence GACAGTGTGACATCCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035727051_1035727058 10 Left 1035727051 8:1831196-1831218 CCATGGAGGGACAGTGTGTGGCA 0: 1
1: 0
2: 1
3: 26
4: 209
Right 1035727058 8:1831229-1831251 GACAGTGTGACATCCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035727058 Original CRISPR GACAGTGTGACATCCGTGGA GGG Intronic
No off target data available for this crispr