ID: 1035727109

View in Genome Browser
Species Human (GRCh38)
Location 8:1831502-1831524
Sequence GATGTCACACTGTCCCTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 5, 1: 0, 2: 5, 3: 11, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035727109_1035727119 26 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727119 8:1831551-1831573 GAGGGACAGTGTGACATCCGTGG No data
1035727109_1035727115 4 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727115 8:1831529-1831551 GAGGGACAGTGTGACGGCCGTGG No data
1035727109_1035727117 8 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727117 8:1831533-1831555 GACAGTGTGACGGCCGTGGAGGG No data
1035727109_1035727120 29 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727120 8:1831554-1831576 GGACAGTGTGACATCCGTGGAGG No data
1035727109_1035727113 -2 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727113 8:1831523-1831545 TCCGTGGAGGGACAGTGTGACGG No data
1035727109_1035727121 30 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG No data
1035727109_1035727116 7 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727116 8:1831532-1831554 GGACAGTGTGACGGCCGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035727109 Original CRISPR GATGTCACACTGTCCCTCCA CGG (reversed) Intronic
902282682 1:15385933-15385955 ACTGTCACACTGTCACTGCAGGG - Intronic
907080551 1:51617590-51617612 GACTTTACACTGTCCCACCAAGG + Intronic
908545706 1:65160173-65160195 TAAGACACACTGTCCCTACATGG - Intronic
912498673 1:110107507-110107529 GATGTCAGGCTGGCCTTCCAAGG - Intergenic
913270408 1:117087642-117087664 GATGACACCCTGCCCCTCCCTGG + Intronic
913594962 1:120366466-120366488 GTAGTCACACTGTCCATCAAAGG + Intergenic
913942812 1:125123682-125123704 GGTGTCAGTCTGTCCCTACAGGG - Intergenic
914092306 1:144512520-144512542 GTAGTCACACTGTCCATCAAAGG - Intergenic
914237645 1:145826701-145826723 GATACCATACTGACCCTCCATGG - Exonic
914306225 1:146421350-146421372 GTAGTCACACTGTCCATCAAAGG + Intergenic
914595825 1:149151458-149151480 GTAGTCACACTGTCCATCAAAGG - Intergenic
915228989 1:154431854-154431876 GATTTCACACCGTCCCGCCCAGG - Intronic
915822186 1:159036108-159036130 GTTGTTACACTGTCTCTGCAGGG - Intronic
917091337 1:171356516-171356538 AAGGTCACACAGTCCTTCCAAGG + Intergenic
918188062 1:182145095-182145117 GATGTGAGACTGGCCTTCCAAGG + Intergenic
918381140 1:183956548-183956570 GCTGTCTCACTCTCCCTCCTGGG + Intronic
919944444 1:202309222-202309244 GCTTTCTCTCTGTCCCTCCAGGG - Intronic
922002718 1:221496070-221496092 GATGTCACACTGGAGCTCTATGG - Intergenic
923723776 1:236488712-236488734 GATGGCACTCTGTCTCTCCCAGG - Intergenic
924567410 1:245210225-245210247 GATGTCACCCTGCCCATCCCTGG - Intronic
1062947549 10:1472885-1472907 GCCGTCACACTGTCTCTCTACGG + Intronic
1066375490 10:34854588-34854610 GATGTCACTTTGCACCTCCAGGG + Intergenic
1066953623 10:42145392-42145414 GGTGTCAGTCTGTCCCTACAGGG + Intergenic
1068118095 10:52756723-52756745 GATGTAACACATTCCATCCATGG - Intergenic
1068434828 10:56976830-56976852 TATGTTACACTGTCCCTCTCAGG - Intergenic
1070831355 10:79419958-79419980 GATGTGAAACTGGCCCTCCTAGG + Intronic
1071582576 10:86786574-86786596 TTTGTCACAGAGTCCCTCCAGGG + Intronic
1075968947 10:126636946-126636968 GAAGTCACACACTCCTTCCAAGG - Intronic
1076559689 10:131353281-131353303 GCTGCCACTCTGTCCCTCCAGGG - Intergenic
1076857920 10:133126695-133126717 GATGAGACTCTGCCCCTCCAAGG + Intronic
1081306869 11:41523111-41523133 AATGCCACAATCTCCCTCCAGGG - Intergenic
1081392342 11:42543508-42543530 CCTGTCCCACTGTCCTTCCAGGG - Intergenic
1082997325 11:59264372-59264394 GAAGTCTCACTGTCCCTCTTTGG - Intergenic
1084679363 11:70657322-70657344 TATTTCACACCATCCCTCCAAGG + Intronic
1087103242 11:94384945-94384967 GATGTCAGTCTGCCCCTCCTGGG - Intronic
1096117679 12:49064969-49064991 GATGCCACACTGTGTGTCCAGGG + Exonic
1096514389 12:52148149-52148171 GTTGTGTCACTGTCCCTCCCAGG + Intergenic
1097435774 12:59550764-59550786 AATGTCATCCTGTCCCTCCAGGG - Intergenic
1099970221 12:89492694-89492716 GATGTCACGCTGACCAGCCAAGG - Intronic
1102222780 12:111205571-111205593 AATGGCACACAGTCCCTCAAGGG - Intronic
1102493969 12:113306542-113306564 GATTTCACACTGGCTCGCCAGGG - Exonic
1102980366 12:117236506-117236528 GGAGTCCCACTGGCCCTCCATGG + Intronic
1104284463 12:127412101-127412123 GTTGTTACACTGTCTCTCTAAGG + Intergenic
1108805079 13:54144930-54144952 GAAGAGAGACTGTCCCTCCAGGG + Intergenic
1111364129 13:87219081-87219103 GATGTCACTGTCTACCTCCAGGG - Intergenic
1113030585 13:105989934-105989956 GAAGTCAGACTGTCCCTCAGGGG - Intergenic
1114370122 14:22077302-22077324 GTTGGCAGACTGTCCCTCCCAGG + Intergenic
1115055496 14:29121319-29121341 GGTGTCACACTGTGTCTCCCAGG - Intergenic
1116020557 14:39455120-39455142 GATGTCCCTCTCTCCCTCCAAGG + Intergenic
1116518606 14:45826175-45826197 AATATCACCCTCTCCCTCCATGG - Intergenic
1118877404 14:69796943-69796965 GATGCCATACTGTGCCACCAGGG + Exonic
1120519424 14:85509231-85509253 GTTGTAACAGGGTCCCTCCAGGG - Intergenic
1121728455 14:96169943-96169965 CATGTCACACTGTACATCCAAGG - Intergenic
1122725085 14:103745256-103745278 GATGTGTCGCTGTCCCTCCTGGG + Intronic
1122767466 14:104082062-104082084 GATGGCCAAGTGTCCCTCCAGGG + Intergenic
1124337836 15:28870360-28870382 AATGTCACAGTGTCCTTCCTTGG + Intergenic
1127738823 15:61876295-61876317 GAAGTTACACTGTCCTTGCATGG + Intronic
1128636561 15:69306103-69306125 GCTGTCAGGCTGTCCCTGCAGGG + Intronic
1132731473 16:1364608-1364630 GAAACCACACTGTCGCTCCAGGG + Intronic
1134123061 16:11598257-11598279 GAGGCCCCACTGTCTCTCCAGGG + Intronic
1134624374 16:15713521-15713543 GGTCTCACTCTGTCCATCCAGGG + Intronic
1137083690 16:36097302-36097324 GGTGTCAGTCTGTCCCTACAGGG + Intergenic
1138224897 16:55284708-55284730 GAAGTCACACAGTCTCCCCAAGG + Intergenic
1140118329 16:72062010-72062032 GATGTCACTCTCTCTCACCAAGG + Intronic
1140120360 16:72078194-72078216 GATGTCACTCTCTCTCACCAGGG + Intronic
1141074506 16:80991240-80991262 GAAGTTACCCTGTTCCTCCAAGG - Intronic
1141876588 16:86829053-86829075 GATGTTACAGCGACCCTCCAAGG - Intergenic
1142235028 16:88918100-88918122 GAGGCCACGCTGTCTCTCCATGG - Intronic
1143011046 17:3866342-3866364 GATGGCACAGCATCCCTCCATGG - Intronic
1145690739 17:26736450-26736472 GGTGTCAGTCTGTCCCTACAGGG - Intergenic
1148111651 17:45147773-45147795 GCAGTCACACTGTCCCTTTAAGG + Intergenic
1149544199 17:57491038-57491060 GGTGTCACACTGCCCCTCGTGGG + Intronic
1151508266 17:74543264-74543286 CAGGTCACCCTGTCCCTCCCTGG - Intronic
1154094506 18:11399457-11399479 CATGTCTCACAGTCCCTGCAAGG + Intergenic
1154269181 18:12904625-12904647 CATGTGCCACTGTGCCTCCATGG + Intronic
1157524316 18:48367887-48367909 GGTTTCCCACTCTCCCTCCATGG - Intronic
1158458565 18:57628462-57628484 GGTGTCACTCTGGCCCTCCTAGG - Intergenic
1165098691 19:33425369-33425391 GAGGCCACATTGTCCCTCTAAGG + Intronic
1165116101 19:33529728-33529750 AAGGTCACACTCTCTCTCCAGGG - Intergenic
1166242882 19:41505884-41505906 AATATCACACTCTCCCCCCAAGG + Intergenic
1166698066 19:44865546-44865568 GACGCCACGCTGGCCCTCCACGG + Exonic
1202670398 1_KI270709v1_random:44557-44579 GGTGTCAGTCTGTCCCTACAGGG - Intergenic
925735195 2:6957852-6957874 GATGGCCCACAGTCCCTGCAAGG - Intronic
925778386 2:7356955-7356977 GAGGACACACTGTCCCTCAGCGG - Intergenic
926957459 2:18317086-18317108 AATGTCACACCCACCCTCCAAGG - Intronic
927278603 2:21283385-21283407 TAAAACACACTGTCCCTCCACGG - Intergenic
927326851 2:21814979-21815001 GATGTAACACTATCCCTTGATGG + Intergenic
934846865 2:97666882-97666904 GGTGTCACCCTGTCTCTCCTAGG + Intergenic
939621310 2:144422344-144422366 GATGTCACACTTTCCCTTCTTGG + Intronic
940869678 2:158849496-158849518 AATGTCATCCTGTGCCTCCATGG + Intronic
941533750 2:166697691-166697713 AATGTCACCCTCTCCCCCCATGG - Intergenic
946638858 2:221761066-221761088 GATATCAAACTGAACCTCCAAGG + Intergenic
947528752 2:230895360-230895382 AATGTCATACTGTGCCACCAAGG + Intergenic
947994496 2:234515603-234515625 GAGGGCTCACTGTGCCTCCACGG + Intergenic
948231607 2:236352952-236352974 ACTGTCACACTGCCCCCCCAGGG + Intronic
1172882334 20:38210143-38210165 GAGGCCACAGTGCCCCTCCATGG - Intergenic
1175537985 20:59728840-59728862 CATGGCACACACTCCCTCCACGG - Intronic
1175568274 20:59998253-59998275 GCTTTCACTCTCTCCCTCCAAGG - Intronic
1175695189 20:61097911-61097933 GATGTCCCTCTGTTTCTCCAGGG - Intergenic
1178929455 21:36804935-36804957 GTTGACAAACTGTCTCTCCATGG + Intronic
1179545786 21:42111479-42111501 GATGGCCCACTGGCCCTCCCTGG + Exonic
1179633895 21:42695273-42695295 GATGGCTCAGAGTCCCTCCAAGG - Intronic
1179727686 21:43349440-43349462 GAGGTCACACAGGGCCTCCAGGG - Intergenic
1181983390 22:26782226-26782248 CTTGTCAGAATGTCCCTCCAGGG - Intergenic
1182867619 22:33617951-33617973 AATGTGCCACAGTCCCTCCAAGG + Intronic
1183057531 22:35316001-35316023 GATGTCACGCTGTCCTGCAAGGG - Intronic
1184797896 22:46742349-46742371 GATGTCCCCCTGGCCCTCCAGGG - Intergenic
1203236079 22_KI270732v1_random:2467-2489 GGTGTCAGTCTGTCCCTACAGGG - Intergenic
1203324451 22_KI270738v1_random:719-741 GGTGTCAGTCTGTCCCTACAGGG + Intergenic
950143293 3:10630015-10630037 GACCTCTCACTGTCCGTCCAAGG + Intronic
950391820 3:12702754-12702776 GATCTCACTCTGTCCCTGCCAGG - Intergenic
950677825 3:14565223-14565245 CATGTAACACTGTCTCCCCAAGG - Intergenic
951782611 3:26380966-26380988 GATGTTCCATTGTCCCTTCAAGG - Intergenic
952270739 3:31829009-31829031 GATTTCAGACTGTCCTTCCTGGG + Intronic
954243881 3:49315751-49315773 GATGTTACAGGGTCCCACCATGG - Intronic
954394764 3:50287641-50287663 GATGTCACCTTTGCCCTCCAAGG - Exonic
955823901 3:62924704-62924726 GAAGTCAGACTGTAGCTCCAGGG + Intergenic
955895101 3:63690729-63690751 GATGTCAAACTGGCCCTTTAGGG - Intergenic
956531986 3:70230982-70231004 GATGCTGCACTGACCCTCCAGGG + Intergenic
959076959 3:101759496-101759518 GAGGTCACACTGATACTCCATGG + Intronic
961168098 3:124777327-124777349 GATGTCCCACAGCCCCTCCGTGG - Intronic
961738148 3:129015182-129015204 GCAGCCACACTGACCCTCCAGGG + Intronic
969848064 4:9935337-9935359 GCTGTCTCACTGTCCCTCGGAGG + Intronic
970706695 4:18812891-18812913 GAAGTCACACTGTCCCTGGGAGG - Intergenic
971348870 4:25838624-25838646 GATGTCACCTTGAACCTCCAAGG + Intronic
971897822 4:32619921-32619943 GTGGTCACATTGTCCCACCATGG - Intergenic
972927125 4:44023350-44023372 GAGGGCACACTGTCCCTCCATGG + Intergenic
977306315 4:95327919-95327941 GCTGTCACACTGACTCTTCACGG + Intronic
987014511 5:13804354-13804376 GATGGCACACTGTCCAACGAAGG - Intronic
992565164 5:77988827-77988849 CATTTCATACTGTCCCTGCAGGG + Intergenic
992659466 5:78944671-78944693 GATGTCAGTCTGCCCCTACAAGG + Intronic
996086432 5:119310204-119310226 GATGTCACTCTTTCGCTCCCTGG + Intronic
997663009 5:135603793-135603815 GAGGCCTCACTGTCCCTACAAGG + Intergenic
997839158 5:137222802-137222824 GGGGCCACACTGTCCCTCAAGGG + Intronic
999381103 5:151122132-151122154 GGTGCCACACTGTACCTCCATGG + Exonic
1003271503 6:4611649-4611671 GATGGCCCACAGTCCTTCCAAGG - Intergenic
1013563546 6:111331692-111331714 GATATCACAGTGTCCCCCAATGG - Exonic
1015286712 6:131493537-131493559 GATGTTACCTTGTCCCTCAAGGG + Intergenic
1015964481 6:138684230-138684252 GATGTCAGACTGTCTTTGCAGGG - Intronic
1018116420 6:160590245-160590267 GATTTCCCGCCGTCCCTCCAAGG - Intronic
1018453819 6:163934361-163934383 GATACCACAATGTCCCTCCTGGG + Intergenic
1018606963 6:165607979-165608001 GATGCCACAATGTCTCTCCCAGG + Intronic
1018632869 6:165835588-165835610 GATGTCTCACAGCCCTTCCAGGG + Intronic
1023964581 7:44956350-44956372 TGTGACACACTGTCCCTCCCAGG - Intergenic
1024576594 7:50769519-50769541 AATGTCTCACCCTCCCTCCAAGG + Intronic
1025320911 7:58092190-58092212 GGTGTCAGTCTGTCCCTACAGGG - Intergenic
1025479217 7:60961212-60961234 GGTGTCAGTCTGTCCCTACAGGG - Intergenic
1026647416 7:72184151-72184173 CATGCCACGCTGTGCCTCCAGGG - Intronic
1029342905 7:99959076-99959098 AATGTCACCCTCTCCCTCCAGGG - Intergenic
1029650179 7:101886153-101886175 GATGTCTCAGTGACCCTACAGGG + Intronic
1031010370 7:116520231-116520253 TATGTCACTCTGTCCGTCCTTGG - Intergenic
1032522248 7:132554255-132554277 ATTGTCACACTGTCCCCCCAGGG - Intronic
1032727269 7:134602353-134602375 GTTGTCACTCTCTCCCACCAAGG + Intergenic
1034379589 7:150679090-150679112 GATGTCAGTCTGCCCCTCCTGGG - Intergenic
1034501156 7:151451862-151451884 GAAGTCACACTGTCCCCACCAGG + Intergenic
1035117652 7:156537904-156537926 GATGTGACTCTGTTCCTCAAGGG - Intergenic
1035716891 8:1762426-1762448 GATGTCACCCTGGCTCTCCTAGG + Intronic
1035727037 8:1831121-1831143 TCTCCCACACTGTCCCTCCATGG - Intronic
1035727055 8:1831220-1831242 GATGTCACACTGTCCCTCCACGG - Intronic
1035727065 8:1831262-1831284 GCCGTCACACTGTCCCTCCACGG - Intronic
1035727077 8:1831326-1831348 GCCGTCACACTGTCCCTCTATGG - Intronic
1035727081 8:1831348-1831370 GATGTCACACTGTCCCTCCATGG - Intronic
1035727090 8:1831390-1831412 CATCACACACTGTCCCTCCACGG - Intronic
1035727100 8:1831458-1831480 GATGTCACACTGTCCCTCCACGG - Intronic
1035727105 8:1831480-1831502 GCCGTCACACTGTCCCTCCACGG - Intronic
1035727109 8:1831502-1831524 GATGTCACACTGTCCCTCCACGG - Intronic
1035727114 8:1831524-1831546 GCCGTCACACTGTCCCTCCACGG - Intronic
1035727118 8:1831546-1831568 GATGTCACACTGTCCCTCCACGG - Intronic
1035727123 8:1831568-1831590 GCCGTCACACTGTCCCTCCACGG - Intronic
1039396235 8:37227596-37227618 TATGACACGCTCTCCCTCCATGG + Intergenic
1040994578 8:53389007-53389029 GAAATCACATTGTCCCTACATGG + Intergenic
1040995208 8:53394091-53394113 GAAATCACATTGTCCCTACATGG - Intergenic
1040999453 8:53436375-53436397 AATGCCACATTGTGCCTCCAAGG - Intergenic
1042879088 8:73467568-73467590 CTTCTCACACTGTCCCTCTAAGG + Intronic
1043429815 8:80183961-80183983 GATGTCATTCTGTCGCCCCAAGG - Intronic
1049413738 8:142485551-142485573 GAGGTGACACTCTCCCTCCTTGG - Intronic
1051072798 9:13193244-13193266 GATGTCCCACTGTCGCTTCCAGG + Exonic
1053210619 9:36224248-36224270 GAGGTCTCACTGTACCTCCCAGG - Intronic
1055191446 9:73529748-73529770 TATGTTAGACTGTGCCTCCATGG - Intergenic
1056118467 9:83463823-83463845 GATGACACACTGGCCATCAATGG - Intronic
1058962490 9:110005419-110005441 GATGTCAGTCTGCCCCTCCTGGG + Intronic
1203779499 EBV:93177-93199 GATGTCACGCTGTTCATCCTTGG - Intergenic
1203651784 Un_KI270751v1:132045-132067 GATGTCAGTCTGCCCCTACAGGG + Intergenic
1185916999 X:4046950-4046972 GATGTCACCCTGGCTCTCCTAGG + Intergenic
1188118661 X:26277822-26277844 TATGTCACACTGTCACTGCTGGG + Intergenic
1196162663 X:112502778-112502800 GGTGTCAGTCTGTCCCTGCAAGG - Intergenic
1196710319 X:118755307-118755329 AATGCCAGACTGTCCCTACAGGG - Intronic
1198577186 X:138023393-138023415 GATGACATAGTGTCCCTCCTTGG + Intergenic