ID: 1035727112

View in Genome Browser
Species Human (GRCh38)
Location 8:1831511-1831533
Sequence GACAGTGTGACATCCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035727100_1035727112 30 Left 1035727100 8:1831458-1831480 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727112 8:1831511-1831533 GACAGTGTGACATCCGTGGAGGG No data
1035727105_1035727112 8 Left 1035727105 8:1831480-1831502 CCGTGGAGGGACAGTGTGACGGC 0: 4
1: 1
2: 6
3: 9
4: 104
Right 1035727112 8:1831511-1831533 GACAGTGTGACATCCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035727112 Original CRISPR GACAGTGTGACATCCGTGGA GGG Intronic
No off target data available for this crispr