ID: 1035727121

View in Genome Browser
Species Human (GRCh38)
Location 8:1831555-1831577
Sequence GACAGTGTGACATCCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035727114_1035727121 8 Left 1035727114 8:1831524-1831546 CCGTGGAGGGACAGTGTGACGGC 0: 4
1: 1
2: 6
3: 9
4: 104
Right 1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG No data
1035727109_1035727121 30 Left 1035727109 8:1831502-1831524 CCGTGGAGGGACAGTGTGACATC 0: 5
1: 0
2: 5
3: 11
4: 167
Right 1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035727121 Original CRISPR GACAGTGTGACATCCGTGGA GGG Intronic
No off target data available for this crispr