ID: 1035728977

View in Genome Browser
Species Human (GRCh38)
Location 8:1841831-1841853
Sequence CGCGGCCCCAGTTCCCGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035728977_1035728997 26 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728997 8:1841880-1841902 TGGGGCCGCGGCGGGAACTGGGG No data
1035728977_1035728988 6 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728988 8:1841860-1841882 ACTGGGGCCGCGGCGGGAACTGG No data
1035728977_1035728990 8 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728990 8:1841862-1841884 TGGGGCCGCGGCGGGAACTGGGG No data
1035728977_1035728995 24 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728995 8:1841878-1841900 ACTGGGGCCGCGGCGGGAACTGG No data
1035728977_1035728994 18 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG No data
1035728977_1035728996 25 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728996 8:1841879-1841901 CTGGGGCCGCGGCGGGAACTGGG No data
1035728977_1035728983 -10 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728983 8:1841844-1841866 TGGGGCCGCGGCGGGAACTGGGG No data
1035728977_1035728989 7 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728989 8:1841861-1841883 CTGGGGCCGCGGCGGGAACTGGG No data
1035728977_1035728993 17 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728993 8:1841871-1841893 GGCGGGAACTGGGGCCGCGGCGG No data
1035728977_1035728986 -1 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728986 8:1841853-1841875 GGCGGGAACTGGGGCCGCGGCGG No data
1035728977_1035728985 -4 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728985 8:1841850-1841872 CGCGGCGGGAACTGGGGCCGCGG No data
1035728977_1035728987 0 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728987 8:1841854-1841876 GCGGGAACTGGGGCCGCGGCGGG No data
1035728977_1035728992 14 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG No data
Right 1035728992 8:1841868-1841890 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035728977 Original CRISPR CGCGGCCCCAGTTCCCGTCG CGG (reversed) Intronic